progress bar
progress bar

Logo

Create Account | Login

Username:
Password:
 
  
Forgot Password?
Create Account
 
 
Feedback Order Now
Oligos

Oligos

  • Express Oligos - Updated!
  • Custom Oligos in Tubes
  • Custom Oligos in Plates
  • EXTREmers in Tubes
  • EXTREmers in Plates
  • qPCR Probes
  • MGB Probes
  • Custom RNA Oligos
  • Custom Chimeric Oligos
  • siMAX siRNA
  • Standard Primers
  • All options

Sequencing

Sequencing

  • Sequencing Dashboard
  • SimpleSeq Kits
  • Prepaid Plates
  • FlexReads
  • Submit in Tubes
  • Submit in Plates
  • Submit Ready2Load Plates
  • Submit ShortSeq Plates
  • My Primers
  • Shipping Labels & More
  • Submission Guidelines
  • Download Your Results
  • All options

Next-Gen Seq

Next-Gen Seq

  • Quote Project

Genes

Genes

  • GeneStrands
  • Gene Synthesis

Evocard

Evocard

  • Order / Refill Card

Account

Account

  • Group Admin Tool New!
  • My Orders & Invoices
  • My Quotes

0

Cart

MENU
  • Products & Services
    • DNA/RNA Synthesis
      • All Oligo Options
      • Express Oligos
      • EXTREmer Oligos
      • cGMP Oligos
      • Custom DNA Oligos
      • Custom RNA/Chimeric Oligos
      • Oligos for NGS Applications
      • qPCR / MGB Probes
      • CRISPRs Products
      • siMax siRNA
      • Purification and Yields
      • Modifications
      • Price List
    • DNA Sequencing
      • All Sequencing Options
      • Sequencing Help Hub
      • Overnight Sequencing
      • Tube Sequencing
      • Plate Sequencing
      • SimpleSeq Kits
      • FlexReads
      • Premium Sequencing Services
      • Clinical & GLP Services
      • Shipping Samples
      • Sample Guidelines
      • Universal Primers
      • Download Your Results
      • Price List
    • Gene Synthesis
      • All Gene Options
      • GeneStrand Fragments
      • Custom Genes
      • Gene Vectors
      • Price List
    • Next-Gen Seq
      • All NGS Options
      • Plasmid Verification
      • 16S Microbiome Profiling
      • Resequencing & Amplicons
      • Bioinformatics
      • Library Service
      • Metagenome Analysis
      • GenoTyping & Applied
  • Resources
    • Account
      • My Orders
      • My Quotes
      • My Group
      • Account Settings
      • Address Book
      • Upload & Order Forms
      • Sequencing Dashboard
      • Preferences
      • Manage Primers
      • Dropboxes Nearby
    • Solutions
      • EVOcard Payment Method
      • Core Labs Partnership & Trade-In
      • Custom Projects
      • eProcurement, B2B & More
      • Bulk Shipping
    • Other Resources
      • Customer Publications
      • FAQs
      • GENEius
      • Molecular Calculations
      • Order Status Updates
      • Benefits of One Supplier
    • Tools
      • Mobile App
      • Quoting System
      • Groups / Sharing Tool
      • Oligo Analysis
      • PCR Primer Design
      • Sequencing Primer Design
      • Tools to View Seq Data
      • qPCR Assay Design
      • Biplex qPCR Assay Design
  • About Us
    • About Us
      • About Eurofins
      • Vendor Information
      • Quality Control
      • Environment & Sustainability
      • Distributors
      • Careers
    • News
      • Latest News
    • Promotions
      • Current Promotions
      • Terms & Conditions
  • Contact
  • Products
    • DNA/RNA Synthesis
    • DNA Sequencing
    • Gene Synthesis
    • Next-Generation Sequencing
    • DNA/RNA Synthesis
    • DNA Sequencing
    • Gene Synthesis
    • Next-Generation Sequencing
    • DNA/RNA Synthesis
    • DNA Sequencing
    • Gene Synthesis
    • Next-Generation Sequencing
    • DNA/RNA Synthesis
    • DNA Sequencing
    • Gene Synthesis
    • Next-Generation Sequencing
  • Resources
    • Account
    • Solutions
    • Other Resources
    • Tools
    • Account
    • Solutions
    • Other Resources
    • Tools
    • Account
    • Solutions
    • Other Resources
    • Tools
    • Account
    • Solutions
    • Other Resources
    • Tools
  • About Us
    • About Us
    • News
    • Promotions
    • About Us
    • News
    • Promotions
    • About Us
    • News
    • Promotions
  • Contact
  • Oligos
  • EXTREmers in Tubes

  EXTREmer Oligonucleotides in Tubes — Order Help

You can order EXTREmers in tubes or plates. Please use the 'EXTREmers in plates' quick order link to have the oligos delivered in plates (min. 24 oligos/plate). To order EXTREmers in tubes, please use the order from below.

The specifications for EXTREmers are the following:

Feature Details
Allowed sequence length 60–200 bases
Quantity Delivered 4 nmol
Modifications Single letter IUB codes and other limited modifications
Purification option Only salt-free
Quality ControlESI MS or CGE

You can either manually enter the details of the sequences and desired modifications, Copy & Paste them from your files, or upload the excel file after downloading the same from the link below and filling the required fields.

Manual Entry:
Step 1: Select the number of EXTREmers you would like to order.
Step 2: Enter the sequence of the EXTREmer. Choose the desired modifications from the dropdown list in the 5′ terminus. To add internal modifications, a) place the cursor at the appropriate position, b) select the modification, and c) hit insert. Alternately, you can manually type the designator code in the sequence
Step 3: Add to cart.

Copy & Paste:
When you copy and paste your sequence from your files, ensure that the name and the sequence of the EXTREmer are separated using one of the expected delimiters. Please do not include spaces or any other delimiters in the name of the EXTREmer.

Upload File:
You can enter the details of your sequence into the excel file after downloading the same from the link provided below. To enter modifications, type the designator for the mods at the appropriate positions. These designators are provided in helpful tips sheet of the template. Please note that you can review and edit the sequence after you upload the file.
 
  • Select Your Entry Format
  • Specify your individual oligos
 

Entry Formats



Number of oligos
 
Select the number of EXTREmer oligos you wish to order; the number can be increased in the next page. You can manually type in the sequence and select additional options in the next page.
XLS icon
Click on the XLS image icon to download and complete the Excel upload form to order EXTREmer oligos.
 
 
 
PLEASE NOTE:
  • Accepted file types include xls, xlsx, csv, and txt.
  • The unique names of the oligonucleotides must be ≤17 characters long.
  • The length of the EXTREmer sequences must be between 60 and 200 bases long.
 
 
Paste in the assigned unique name and the sequence of the EXTREmer oligo(s) in the field above.
name1 ACGTACGTACGTACGTCATCATCATCATCATCATCCCAACACACGATAGAT
name2; [BIO]GTATTAG[I]ATATAC[U]CACACAAGATAGAGGACAGATAGAGAGAGA
name3, actgctgctgcctgacatgattagactcatttctctctcctc

Accepted delimiters include tab, space, and semicolon. Please do not included spaces in the sequence of the the EXTREmers.
*Delimiters refer to a character or symbol that separates a character string, word, or data item.
 
 
Next
 
 
 

2017 - Copyright Eurofins Genomics LLC

Information

  • - About Us
  • - Careers
  • - Contact Us
  • - Policies

Company Links

  • - Terms & Conditions
  • - Corporate
  • - Privacy
  • - Investor Relations

Change Region

  • - India
  • - Europe
  • - Japan
  • cGMP Compliant
  • GLP Certified

PROD - HSV

| 9.0.88.60