Article page icon

FAQs

General & Common Questions

Changes in the website

How do I download my Sequencing Results?
Go to your Order History. Next, click an order to expand and reveal the download link. To visit the Order History page, click one of the many links located throughout the website, including in the header beside your account information, the main menu, and the order now menu.
Orders appear to be missing in my Order History page, what happened?
The most common cause of this is the date range being too short.  By default, the Order History page loads one month of orders.  To resolve it, simple expand the date range to view more orders.  If you continue to experience problems, please click the chat button in the header and our support team will assist you.
Several pages on your website now look different. What changes have you made?
We are continously striving to provide content that is most relevant to you and the goods/services we offer. We are continuing to integrate the functionalities and content from the Operon legacy website into the Eurofins Genomics website. We have taken great strides towards this. Briefly, we have
  • Integrated nearly all the pages on the legacy operon site to the Eurofins Genomics site. Now you do not need to maintain two log in names and passwords
  • Enabled customers using our sequencing services to log on to and use the Eurofins Genomics website without having to log on to our legacy systems
  • Streamlined our portfolio to focus on products and services that we believe allow to best serve you.
  • Reorganized our products/services page for each Business Unit (see an example here.)
  • Taken steps to make navigation between pages easier by providing relevant links on each page.
I want to order goods and services. What is the quickest way to order?
The quickest way to order goods and services is to use the quick order menu displayed when you click the 'Order Now' link located on the top of the page. The links on the dropdown list will take you directly to the order pages.
I want to learn more about the goods and services offered by you.
Use the menu on the gray horizontal bar to browse the various business units using the All product options. You will be able to find the information specific to each product or service through these and other links.

Changes in products and services offerings

What are the changes in the oligonucleotides business unit?
We are most excited about the changes that have taken place and will take place in the near future for the portfolio of Custom Oligonucleotides business unit.These are the changes in the product portfolio:
Goods/Services Status Comments/Links
Custom DNA Oligos in Tubes Min OD displayed for Unmodified Oligos. The features and other details of the available oligos are provided here. Please note that we are now displaying Mininmum OD guaranteed for unmodified oligos when they are added to the cart.
Custom DNA Oligos in Plates Unchanged
Express Oligos Unchanged Click to order Express Oligos
EXTREmers in Tubes New We are excited about the introduction of EXTREmers - these are long, low-yield, high-fidelity synthetic oligos. Read about them here.
EXTREmers in Plates New
qPCR Probes Unchanged The dual-labled probes are being continued. The specifications and details are included in the same page as the newly introduced MGB Probes - see below.
PCReady Primers Discontinued We have discontinued this product; instead we have introduced a one-click order editor for most widely used primers.
MGB Probes New We are pleased to offer MGB probes. These taqman MGB probes are prepared in our Germany labs but are available for our customers in the US to be delivered in 8–10 days. read about the MGB probes here.
Standard Primers New Our continued success in the sequencing services has allowed us to identify the various sequences widely used for sequencing inserts in various standard vectors. We are now offering a one-click ordering protocol for standard sequencing primers.
TRUEmers/Synthetic Bio Oligos Discontinued Please contact our sales team at GenomicsUS@eurofins.com with feedback.
Stock Oligos Discontinued Please see Standard Primers. Instead of having the primers in stock, we will allow you to order the same using a one click order protocol.
cGMP Oligos Unchanged Oligos prepared under continous good manufacturing process will be offered. Please go to this page to learn more about the Benefits of getting oligos manufactured under cGMP.
Mixing and Pooling Discontinued Please contact our sales team at GenomicsUS@eurofins.com with feedback.
Large Scale Synthesis Discontinued Please contact our sales team at GenomicsUS@eurofins.com with feedback.
ssRNA Unchanged Please read our capabilities with respect to the preparation of ssRNA here.
Chimerics Unchanged Please read our capabilities with respect to the preparation of chimerics here.
siRNA Unchanged Please read our capabilities with respect to the preparation of siRNA here.
Oligo Properties Calculator Unchanged The traditional tool is hosted on our legacy server. This tool will be integrated into the this website in the coming months.
What changes will I see in the DNA sequencing services?
The web portal for the sequencing business unit has undergone the most significant changes. Previously, you had to place orders using the legacy Operon website, now we have deployed the order control on the Eurofins Genomics server. Please do familiarize yourself with the various order editors. A quick general summary of the strategy we have employed while redefining the various order editors is the following:
  • Collect only the most critical information required to process the sample. This should reduce the time spent by you while placing the sequencing orders.
  • Allow you to effectively use our in house oligo synthesis facility by including quick sequencing primer order links in the sequencing order editors.
  • Reduce the time and effort spent on placing the orders for sequencing services, share results, and resources through the Groups, Sequencing Dashboard, and Primer Management Tools.

The detailed description of the changes are discussed in the link here. The table below gives a quick overview of the changes based on the type of the service.

Services Status Comments/Links
Overnight Sequencing Unchanged Sequence data from samples meeting specific criteria will be available for download the next morning. Read about it here.
Tube Sequencing Simplified and Enhanced order editor, new upload template Simplified, because you do not need to provide unnecesary information, consequently, allowing you place order faster. Enhanced, because you can order primers rapidly using the same order editor. A new Excel template is provided with the new order editor. Place an order for a tube sequencing service it to enjoy the new ordering experience.
Plate Sequencing Simplified and enchanced order editor, new upload template See comments on the tube sequencing order editor above. Besides, you can now submit samples for multiple sequencing reactions in each well. Check out the features of the order editor here. Please use the new template (filled with mock data, if you wish) to test the features of the order editor. 
SimpleSeq Kits - Standard Simpler processes The flexibility and convenience of using prepaid SimpleSeq kit and service is made simpler by automating several process that previously was performed on a call from you. No manual activation is required for most routine services! You can share your kits, tubes in the kits, or sample barcodes withy your colleagues and monitor its use through the sequencing dashboard. If you have never used a SimpleSeq kit, it is time you got one. If you are an user of SimpleSeq kits/services, using it got much simpler. Check out your new Sequencing Dashboard or the primer management tool.
SimpleSeq Kits - Premixed (formerly Webless) Change in the name, service remains unchanged
ShortSeq Plates (formerly Express Plates) Dedicated Order Editor, Change in the name, new upload template Order a sequencing service for premixed samples requiring a read length of ˜550 bp" and supplied in plates is now simpler with the dedicated order editor and per plate pricing. Use the new upload template to submit your samples
Ready2Load Plates Dedicated order editor, new upload template The same timely and rapid service, a new order editor and an upload template for use in the ordering process.
Prepaid Plate Kits for Purified DNA New service, use plate sequencing order editor and upload template We are excited about introducing the prepaid plate sequencing service for samples that are ready for sequencing or for those that require a PCR clean-up step before sequencing. The prepaid plate seqeuncing is the cousin of the SimpleSeq kits, providing the flexibility to place orders for one more reactions from the sample submitted in a single well. Since this is a prepaid plate sequencing service, this ensures effective use your research budget. Read more about the various Prepaid plate services here.  
Prepaid Plate Kits for Crude PCR products New Service, use plate sequencing order editor and template
Clinical Sequencing services New Service We are happy to announce that our sequencing labs have been granted the CAP accreditation and CLIA certification. Our scientists have over 30 yearas of experience handling and developing assays with clinical samples. Please contact CLIA@eurofins.com for questions or projects.
Sequencing Dashboard New feature We have built this resource to ensure that you can effectively manage your sequencing resources. You can monitor the use of your sequencing reactions, your barcodes, or other sequencing related tasks here. Check out the features of the dashboard here - you will need to log in.
Primer Management Tool New feature You can decide which primers you want see in your dropdown list. Simply transfer the primers you want to see on your primers dropdown list (for the plate or tube sequencing orders) to 'my favorite primer' box here.
Activate Kits Discontinued* You do not have to call in to activate the barcodes on your 'unused' SimpleSeq tubes. The sequencing dashabord and FlexRead (see below) allow you to monitor the usage of your sequencing reactions comfortably.
Activate Barcodes Discontinued* The free barcodes are not free floating. You do not need to activate barcodes, Simply order a sequencing service using the barcodes sent to you and the barcodes will automatically appear on your Sequecing Dashbaord.
Free Barcode Labels Unchanged Use the link on this page to order Free barcode labels in a timely manner.
Free Overnight Shipping kit Unchanged  Use the link on this page to order Free Overnight Shipping kit in a timely manner.
Free Tube Bags Discontinued Please contact our sales team at GenomicsUS@eurofins.com with feedback.
FlexPacks New Service FlexPacks replaces the process of 'activation' - a process applicable to unused tubes in the SimpleSeq service. You can either order flex packs - virtual sequencing reactions that you can then redeem later - or order the sequencing services with extra reactions and FlexReads - which are charged as you use them - will get added to your cart.

*Some kits can still be activated, but this is not a necesity anymore. Placing an order with the barcode on the tube of the SimpleSeq kit or a barcode label automatically activates the kit ot the users account. The buyer of the kit or the free labels will, however, be able to monitor the use of the same.

What changes can i see in the portfolio of Gene Synthesis Business unit?
There are no significant changes in the portfolio of products and services offered in the Genes and related services. the layout of the information pages have changed. We have included data to display the quality of these products and have made navigation easier by providing relevant links on the sidebars of each page.
Goods/Service Status Comments/link
Genes Unchanged Standard genes upto 3,000 bp can be ordered through the Gene Synthesis wizard.
GeneStrands gene fragments Minor Improvements The hints have been populated with more relevant information to help you place the order in the most effective manner.
What are the changes in the services offered in the Next Generation Sequencing?
There have been no changes in the Next Generation Sequencing services offered by Eurofins Genomics. Please note that all the Next Generation Services are offered based on quotes after consultation with NGS specialists. In our experience we have found that each project is unique and every researcher is asking specific question based on his or her project goals. Please contact us at GenomicsUS@eurofins.com for a quote or for consultation on NGS projects.

Account and EVOcard related questions

How can i view the details of my orders that were placed on the Operon website?
You can view the details of all your orders (those related to oligos, sequencing, and genes/GeneStrands) by accessing 'My Orders'. This link will appear on the top right corner of your screen after you have logged into the website. We have migrated your order history and other details from the Operon server to your account on the Eurofins Genomics server.
Where can i find the sequence data for my current and previous Sequencing orders?
The sequence data and related information are now availble to you from the 'My Orders' page. You can search and locate your order on the my orders page. Once the order is identified, you can expand the order to get access to the relevant documents. Please familiarize yourself with the order history. You can sort the orders through the business units, dates, or order numbers.
Where can i find my Order History?
The details of all your orders can be accessed through the My Orders page. Please note that we have migrated the orders placed through the legacy Operon website to the Eurofins Genomics server and you should be able monitor the consolidated orders under your order history page.
Where can I find the invoices for my current and previous sequencing orders?
Once you log on to your account, please click on the 'my orders' link locate on the top right corner of each page. On the order page, locate the order for which you need an invoice. Expand the order to find all the details of the order and the relevant documents. Please note that the details of all the orders have now been consolidate under a single Eurofins Genomics account.
How can i find the current status of my orders?
After you log into the www.eurofinsgenomics.com site, you must click on the 'My Orders' link on the top right corner of any page. Locate the order and monitor the status of the order using this 'My Orders' page.
My order involves a shipment. Where can i find the tracking number for the shipment?
After you log into the www.eurofinsgenomics.com site, you must click on the 'My Orders' link on the top right corner of any page. Locate the relevant order and click on the order to see the details of the order and the tracking number associated with the shipment.
Where can I acess the oligo analysis data for my current and previous orders?
You must log in to access these documents. Once logged in, click on the 'My Orders' link appearing on the top right corner on any page, locate the relevant order and find the oligo analysis data there.
Where can i find the upload templates to place the orders for oligos and sequencing services?
Each order editor has a link to the relevant upload template. You can download the same there. Please note that these templates must be used for a successful upload of your sequencing orders.
Where can I find the activated Free barcode labels, SimpleSeq barcodes, and Webless barcodes previously associated with my Operon account?
With this update, we have a sequencing dashoard which displays all the barcodes, SimpleSeq kits and tubes barcodes, associated with your account. This dashboard will allow to manage your sequencing resources effectively. Please provide your feedback if you need additional features on this dashboard. 
I had funds in my EVOcard on the Operon website. How can i use the same to pay for the services on the Eurofins Genomics Website?
Simply select the EVOcard during the checkout. We have reconciled the balances on the EVOcards from the Operon Legacy server and have migrated the same to your EVOcard account on the Eurofins Genomics server. You will be able to use the funds that are available on the EVOcard to order goods and services at the Eurofins Genomics wesite. The new home for managing your EVOcard is here. You can monitor the transactions made using the EVOcard and refill your EVOcard.
Where can i find my EVOcard balances and transactions?
You will be able to locate the balance and transaction history related to EVOcards at this EVOcard managment page. We have migrated the EVOcard balances from the Operon Server to the Eurofins Genomics server. The EVOcard can be used for during check out for your orders.
Do i need to be logged in to order goods/services?
You can checkout of some of our good as a guest, however, to order DNA sequencing services you must be logged into the account. We recommend that you log in for every purchase, since you will not need to enter your shipping adress each time.
Where is the 'Operon Cart' which used to contain my sequencing orders previously?
With the latest update to our website, you can now load all the goods and services into a single cart. The 'Operon' cart is now merged into the Eurofins Genomics cart. We believe this will improve your shopping experience at www.eurofinsgenomics.com.
Where is the oligo property calculator tool?
You can access the oligo property tool by clicking here. Please note this tool is still hosted on the legacy Operon server. We are now working to deploy this tool in the Eurofins Genomics.
Can I save my query parameters in the order history?
You can save your query parameters on the advanced search.

 

Frequently Asked Questions - Oligonucleotides

What is an oligo?
Oligonucleotides are short strands of DNA or RNA molecules that are widely in research, forensics, and genetic testing. The use of the word oligo has widely replaced the use of 'DNA oligonucleotide'. The term oligonucleotide is derived from the greek word 'oligo', which means few, and nucleotide, which indicates the building blocks of nucleic acids. These oligos, which can have custom sequences, are chemically manufactured and sold to researchers. While typically oligo is used as a prefix to indicate a few, the limits in case of oligonucleotides have not been precisely defined. Eurofins Genomics has chemically synthesize oligomers of lengths ranging from 5 to 200 nucleotides (nt).
Why is my oligo colored?
Synthetic oligos vary in appearance depending on a large number of factors. The lyophilized oligo may appear dry or oily with a clear, white, or brownish color. A colored product is not a sign of impurities and should not be a cause for concern. All of Eurofins Genomics’s oligo products meet strict quality control standards before being shipped to our customers.
How long will my oligos last and how should I store them?
Unmodified oligos are stable molecules and can be used for at least 12 months after purchase when stored at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same oligo, aliquot the oligo sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility of contamination with nucleases or bacteria.
How should I resuspend my dry/lyophilized oligos?
Eurofins Genomics oligos are always shipped salt-free. Before opening, spin the tube at 1000 rpm for 5 min to ensure that the oligonucleotides are at the bottom of the tube. It is recommended that the oligonucleotides be resuspended in a sterile buffered solution (e.g., TE at pH 7.0). Please vortex your oligonucleotides thoroughly after resuspension. The oligonucleotides may not readily dissolve in sterile, distilled water. If NaOH is added to the water, the pH will rise to 7.0 and this should help. If the oligonucleotides are resuspended at pH <7.0 (deionized water may have a pH as low as 5.0), the oligonucleotide could begin to degrade and may lose functionality within a couple of weeks.
For optimal long-term storage, it is recommended that the oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry them and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.
What chemistry does Eurofins Genomics use in oligonucleotide synthesis?
Eurofins Genomics uses the industry standard beta-cyanoethyl phosphoramidite chemistry (Caruthers, M. H., 1983, Tetrahedron Lett. 24:245–248) to synthesize oligonucleotides in the 3′ to 5′ direction. For a more granular overview, click here. This chemistry has been proven to be robust and to yield high-quanlity oligos. Different high-throuput synthesizers coupled to different synthetic protocols are used for the synthesis of a range of oligonucleotide products.
What is HPSF purification?
HPSF stands for High Purity, Salt Free. This is a proprietary cartridge-based purification method that provides a highly pure oligo.
Eight elution steps, including in situ cleavage of the dimethoxytrityl (DMT) protecting group, ensures that nearly all n-x oligomers, protecting groups, and salts are washed away.
What quality control methods do you use to monitor the quality of the oligo?
Once the oligo is synthesized and washed, we perform the following analytical tests:
a) OD measurement
The final yield of the oligo is calculated based on the optical density (OD) measurement. The absorbance at 260 nm is recorded. One OD unit of DNA is the amount of DNA in 1.0 mL of ddH2O that gives an absorbance reading A260 = 1.0 when measured using a 1 cm quartz cuvette. 1 OD typically corresponds to ~33 μg/mL of ssDNA.
b) MALDI-TOF MS
The identity of each oligo is verified by mass-spectrometry. Analysis by Matrix Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) is the default method of choice for most of the oligo synthesized by us.
c) Capillary Gel Electrophoresis (CGE)
Analysis by CGE is routinely performed on unmodified oligonucleotides (>60 nt long) which have been purified by RP-HPLC.
Does the sequence of the oligonucleotide have an impact on the feasibility of synthesis or purification?
Over the years, Eurofins Genomics has identified few sequence-dependent features that can make the production of the oligo difficult. One prominent example is the synthesis of oligos containing a high percentage of 'G' residues, in particular, stretches of 'G'. Besides synthetic challenges, these oligo are also difficult to purify, becuase such oligos with 4 or more 'G's in a row tend to aggregate and form a 'guanine tetraplex' (Poon & MacGregor, 1998, Biopolymers 45:427–434). Similarly, oligos with self-complementary sequences tend to form aggregates which can complicate HPSF and HPLC purifications.
What do you mean by the terms Synthesis Scale and Yield?
The term synthesis scale indicates the amount of the first nucleotide of the sequence used to initiate the synthesis. This quantity defines the quantity of reagents used in the subsequent steps.
The synthesis yield is the amount of oligo isolated after the synthesis is completed; this yield is dependent on the coupling efficiency acheived in each chain extending step of the synthesis.
Oligo Length Theoretical Yield
w CE 99.5% w CE 99.0% w CE 98.5%
20-mer 91 83 75
30-mer 86 75 65
40-mer 82 68 55
60-mer 74 55 41
100-mer 61 37 22
How do i order modified custom DNA oligos on the website?
In the custom oligo order editor, enter the name and sequence of the oligo. Then you can select the modifications you want at the 5′ and 3′ using the drop down menus. For modifications in the internal positions, we recommend that you 'insert' the modification where the cursor is placed after the selecting the required modification in the dropdonw menu. Please note that the designators cannot have typographical errors; we therefore recommend that you inset the internal mods. Once you place the order, these oligos will be delivered to you in tubes. For a larger volume of oligos, please use the custom oligos in plates order editor.
What is the turnaround time for my oligo order?
The table here provides the estimated turnaround time for the shipment of a standard unmodified oligo order. Please note that oligos with modifications, post-synthesis purifications or other custom services will have a different turnaround time.
Do you have a recommended annealing protocol?
Summary
Annealing protocols are fairly standard and can be found on the internet through search engines or on different company websites. The protocols are generally the same but may differ in reagents and incubation times / temperatures. Eurofins has a sample annealing protocol attached to this FAQ. The protocol may be modified or optimized to your specifications.

NOTE: Annealed dsDNA oligos should be stored at –20 °C or kept on ice when on the benchtop.

For your convenience Eurofins has an added feature when ordering through the website to have the reverse complement sequence.

Annealing Buffer: 10 mM Tris, pH 7.5–8.0, containing 50 mM NaCl and 1 mM EDTA

1x TE Buffer: 10 mM Tris, pH 7.5–8.0 containing 1mM EDTA

Step 1. Resuspending the Oligonucleotides: Resuspend both complementary oligonucleotides at the same molar concentration, using Annealing Buffer (see note below). For convenience, keep Annealing Buffer volume below 500 μL for each oligo. Annealing should perform well over a wide range of oligo concentrations. For larger scale oligo syntheses, it may be necessary to use larger volumes that can be aliquoted after resuspension.

Step 2. Annealing the Oligonucleotides: Mix equal volumes of both complementary oligos (at equimolar concentration) in a 1.5-mL microfuge tube. Place tube in a standard heatblock at 90–95 °C. Remove the heatblock from the apparatus and allow to cool to room temperature (or at least below 30 °C) on the workbench. Slow cooling to room temperature should take 45–60 minutes. Store on ice or at 4 °C until ready to use. An alternative procedure for annealing involves the use of a thermal cycler. Dispense 100 μL aliquots of the mixed oligos into PCR tubes (500-μL size). Do not overlay the samples with oil. Place the tubes in a thermal cycler and set up a program to perform the following profile: (i) heat to 95 °C and remain at 95 °C for 2 minutes, (ii) ramp cool to 25 °C over a period of 45 minutes, (iii) proceed to a storage temperature of 4 °C. Briefly spin the tubes in a microfuge to draw all moisture from the lid. Pool samples into a larger tube, store on ice or at 4 °C until ready to use.

Step 3. Long Term Storage: It may be necessary to aliquot and lyophilize the annealed sample. After drying, the sample may be stored at –20 °C in a desiccated container. Resuspend the annealed oligos at the desired concentration with sterile distilled water. The annealed pair of oligonucleotides is ready for use.

NOTE: Oligos may also be resuspended in either 1x Ligase Buffer or 1x Kinase Buffer instead of the above Annealing Buffer (prior to annealing).

Unmodified oligos can be used for at least 12 months after purchase when stored wet at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same sequence, aliquot the sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility contamination with nucleases or bacteria.

Before opening, spin the tube at 1000 rpm for 5 min to ensure that the oligonucleotides are at the bottom of the tube. Oligonucleotides should be resuspended in a sterile buffered solution (e.g., TE at pH 7.0). Vortex oligonucleotides thoroughly after resuspension. The oligonucleotides may not readily dissolve in sterile, distilled water. The addition of NaOH to the water until the pH rises to 7.0 may help. If the oligonucleotides are resuspended at pH <7.0 (deionized water may have a pH as low as 5.0), the oligonucleotide could begin to degrade and may lose functionality within a couple of weeks.

For optimal long-term storage, oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry them and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.

Do you synthesize double-stranded DNA oligos?
All of the oligos synthesized at Eurofins are single-stranded DNA oligos. We do produce GeneStrands (>100 bp), which are linear dsDNA gene fragments, and Genes (>100 bp) after ligating and assembling these single-stranded DNA oligos. However, for oligos of length <100 nts, we do not offer dsDNA. To get dsDNA you can order the reverse complement oligo and anneal the oligos using our annealing protocol or the annealing protocol of your choice.
How do i know if my oligo is annealed?
To confirm that the oligos annealed properly, we recommend running the annealed double-strand (ds) oligos in one lane and the single strand (ss) un-annealed oligos in two seperate lanes of a non-denaturing polyacrylamide gel 4–15%. Thaw the double-stranded (ds) DNA on ice and and run a minimum of 5 μL of ds oligo solution (0.5 μM) in lane 1, 5 uL of ss oligo solution (sense; 0.5 μM) in lane 2, and 5 μL of ss oligo (anti-sense; 0.5 μM) in lane 3. The bands in lane 2 and 3 represent the hairpin structures formed by unannealed ss oligo for the sense and anti-sense sequences ordered, and the band should run twice as fast as the ds oligo in lane one of gel. If available a 10 bp sizing ladder should be run in another lane on the gel.
What kind of calculations are used for oligo analysis?
The most common calculations are for Molecular Weight, Extinction Coefficient, Picomoles, Micrograms, Concentration, Melting Temperature, and Annealing Temperature. Explanations of these calculations can be found on our Calculations Page.
Sequenced clone shows a mutation in the oligo. Can this arise from defects in the oligo synthesis?

Mutations or alternations in sequence are rare in synthetic oligos but they can happen. Oligos may become depurinated in some positions during the synthesis process. A longer oligonucleotide is more likely to have more depurinated sites than a shorter oligo. These depurinations may become visible in applications like cloning where single molecules are selected and propagated. Typically the depurinated sites are replaced by any base. Usually only some oligonucleotide molecules are affected. If you have sequenced only one clone and found a 'mutation' in it, sequencing another independent clone will in most cases result in the correct sequence. When choosing clones, it is most important to select independent ones. To get independent clones, the pre-incubation time before plating should be based on the manufacturer instructions of your cloning system. Optimal density of the clones on the plate ensures that well separated clones can be selected.
As the risk of depurinations increases with the length of the oligonucleotide, we recommend the use of short sequences for cloning. If long oligos (>40 nt) have been used for cloning, consider increasing the number of clones that need to be sequenced. More recently, increase coupling efficiencies and accurate reagent delivery mechanims have enabled us to develop oligos with very few sequence errors. The use of these oligos—TRUEmers—can further reduce the number of mutations observed during cloning.
Please note that synthetic oligos do not contain a phosphate at the 5′-end which is necessary for enzymatic ligation reactions. However, the phosphate group can be added as a modification to the 5′-end of the oligo. If you find a 'mutation' in multiple clones please contact GenomicsSupport@eurofins.com.
Are there specific amino linkers that are recommended for attaching esters?
For each potential position for the ester, Eurofins Genomics recommends and uses select amino modifiers as linkers. When you order an ester modification to your oligo sequence, one of these amino linkers are automatically added to your oligo, depending upon position of attachment.

5′ ester modification: Amino Modifier C6
Internal ester modification: Uni-Link amino modifier
3′ ester modification: Amino Modifier C7

Alternatively you can use AminoC6-dT.
What if I want to use a different amino modifier than the default modifier?
Our customers' experiences and our internal research findings demonstrate that these amino linkers are highly reliable for conjugation and work well for the majority of experimental applications. On occasion, however, your experiment may require the fractional increase in specificity that can be achieved if you replace a T base within your sequence with the Amino C6 dT or Amino C2 dT attachments. If you would like to use either of these, please contact us through GenomicsSupport@eurofins.com.
Why do certain dyes have to be put on after synthesis as an ester?
Certain oligo modifications can only be attached to the oligo via a post-synthesis ester conjugation because a form of the modification that can be used directly on the synthesizer is not available. The reaction requires 2 substrates: (1) an oligo which contains an amino linker, and (2) the desired modification. All modifications attached through esters require HPLC purification to eliminate the unreacted substrates.
Do fluorescent dye-labeled oligos require special storage and handling?
Yes. Fluorescent dye-labeled oligos are more fragile than unmodified oligos. Their ability to fluoresce will decrease over time. Before opening, spin the tube at 1000 rpm for 5 minutes to ensure the oligos are at the bottom of the tube. To ensure high quality, store the oligo dry at –20 °C in small aliquots. Note also that fluorescent dye-labeled oligos should be stored in the dark as light can slowly degrade the fluorescent moieties.
For optimal long-term storage, it is recommended that the labeled oligonucleotides should be stored dry at –20 °C in the dark. If numerous experiments are planned using the same oligonucleotide, prepare aliquots, dry all aliquots, and store the aliquots at –20 °C. Use clean, sterile labware for all transfers.
How long will my fluorescent dye-labeled oligos last?
Fluorescent dye-labeled oligos can be used up to 6 months from purchase when stored dried at –20 °C in the dark.
How should I resuspend my fluorescent dye-labeled oligos?
Oligonucleotides labeled with fluorescent dyes, such as 6-FAM, HEX, TET, ROX, and TAMRA should be resuspended in a slightly basic solution (e.g., TE at pH 8.0). Cy3, Cy3.5, Cy5, and Cy5.5 labeled oligonucleotides should be resuspended at pH 7.0. Cy3, Cy3.5, Cy5, and Cy5.5 begin to degrade at pH >7.0. If brought to a pH below 7, it has been shown that the oligo can begin to degrade and may be unusable within a few weeks.
How long will my oligos last and how should I store them?
Unmodified oligos are stable molecules and can be used for at least 12 months after purchase when stored at –20 °C. For long-term storage, oligos should be stored dry at –20 °C. If numerous experiments are planned using the same sequence, aliquot the sample, dry all aliquots, and store at –20 °C. If the oligos are stored wet, avoid repeated freeze-thaw cycles as this process can lead to physical degradation of the oligo. Oligos generally last longer in TE than in water. Careful handling is recommended to avoid the possibility contamination with nucleases or bacteria.
Does Eurofins Genomics provide a Material Safety Data Sheet (MSDS)?
Per OSHA 29CFR1910.1200, Commonwealth of Australia [NOHSC:1005, 1008(1999)] and the latest amendments to the European Union Directives 67/548/EC and 1999/45/EC, Synthetic DNA does not require a Material Safety Data Sheet (MSDS). Synthetic DNA does not contain more than 1% of a component classified as hazardous and does not contain more than 0,1% of a component classified as carcinogenic. Therefore Eurofins Genomics does not provide a MSDS for Synthetic DNA. However, when working with these or any chemical reagents, we always recommend the use of gloves, lab coats, and eye protection. Eurofins Genomics assumes no liability for damage resulting from handling or contact with Synthetic DNA.
How is the Melting Temperature calculated for my oligo?
The melting temperature (Tm) of an oligonucleotide is dependent upon a number of factors including the length and G+C content of the sequence as well as the type and concentrations of cations present, particularly the sodium ion, Na+. A variety of formulas have been used for predicting melting temperatures. The following formula is recommended for oligonucleotides ranging in length from 20 to 100 residues and sodium concentrations ([Na+]) ranging from 0.01 M to 1.0 M. The Tm reported on the data sheets shipped with the oligos assumes a [Na+] of 0.1 M, the log of 0.1 is -1:

Tm = 81.5 + (16.6 * log[Na+]) + (41 * (G+C) / oligo length) – (500 / length)

It is important to remember that different websites, programs, and software may use a different equation for calculating the melt temperature of an oligo. Any calculated Tm is theoretical, and the truest method for determining the Tm of an oligo is through experimental analysis.
What is the maximum length oligo offered by Eurofins Genomics?
For a detailed breakdown on the length and synthesis scale of the oligo nucleotides, please visit the oligo specification page here. EXTREmers are our single stranded long DNA oligos (<200 nt long) while GeneStrands are our linear double stranded oligo that are assembled using single-stranded oligo nucleotides.
Do you have phosphorothioate oligos?
Yes. The phosphodiester backbone, also referred to as the phosphor backbone, is the normal backbone for our synthesized DNA oligos. Phoshphorothiated oligos, sometimes called S-oligos, have a sulfur replacing one of the oxygens in the phosphate backbone between the bases. Oligos with phosphorothioate modification can be used to induce a strong immune response in living organisms, as they are very stable against nuclease degradation.
Here are some examples of how you can order oligos with phosphorothioate bonds):
T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T (Phosphorothioate between every two contigous bases)
T*C*C*A*T*GACGTTCCTGAC*G*T*T (Phosphorothioate between only some bases and phosphodieste between others)
TCCATGACGTTCCTGACGTT (Phoshpodiester between every two contigous bases)
Are there design guidelines for sequencing primers?
Eurofins Genomics strongly recommends the use of software to design DNA sequencing primers. The Oligo Toolkit and Plotter displays secondary structure as well as other useful information such as melting temperature, GC content, etc. For cycle sequencing, primer length should be between 18 and 28 bases with a GC content of at least 50%. The melting temperature of the primer should be between 50 °C and 70 °C. It is important to avoid selecting primers that form dimers or hairpins as molecules in this conformation will not participate in primer template hybridization. Additionally, if a 3′ overhang is formed by a dimer or hairpin, the polymerase will extend and form unwanted products.
Do you have design guidelines for Dual-Labeled Probes / Primers for 5' Nuclease Assay?

Dual-labeled probes (fluorescence quencher or FQ probes) have a fluorescent reporter and a quencher at their 5′ and 3′ ends, respectively. These probes can be used in quantitative PCR systems that take advantage of the 5′→3′ exonuclease activity of Taq DNA polymerase. A probe specific for the sequence of interest is used together with specific PCR primers. This probe is designed to anneal between the PCR primers. During the extension phase of PCR, the 5′→3′ exonuclease activity of Taq DNA polymerase cleaves the fluorescent reporter from the probe. The amount of free reporter accumulates as the number of PCR cycles increases. The fluorescent signal from the free reporter is measured in real-time and allows quantification of the amount of target sequence. There are several design considerations to keep in mind when designing dual-labeled probes. Placement of the probe is important; the probe should be designed first, followed by the design of the PCR primers. The probe should anneal near the center of the amplicon, and the amplicon should be 50 to 150 bases long. The probe's melting temperature should be 68 °C to 70 °C. The probe should be at least 20 bases long to prevent nonspecific annealing. Finally, avoid designing the probe with a dG at the 5' terminus as dG is a weak quencher. Any dG in the primer should be at least 2 residues away from the 5' terminus.

Probe:
G-C Content: 30–80%
polyNNN: Avoid stretches of same nucleotide, especially 4 or more Gs
End Composition: No Gs at 5' end
Tm: 68–70 °C
Strand: Select strand with more Cs than Gs. If the compliment is used, make sure there are no Cs at the 3' end.
Length: Less than 30 bp
Design: Quencher on 3' end dye on 5' end

Primer:
G-C Content: 30-80%
polyNNN: Avoid stretches of same nucleotide, especially 4 or more Gs
End Composition: 5 bases at 3' end should have no more than 2 G/Cs. Try to use As at 3' end so primer dimers will be degraded more efficiently.
Tm: 58–60 °C
Product: 50 to 150 bases
Design: Choose after probe. Design as close to probe as possible without overlap. Have one primer cross one exon junction to amplify mRNA.

How do I design Molecular Beacons?
Molecular Beacons, like dual-labeled probes, have a fluorescent reporter and a quencher at their 5' and 3' ends, respectively. The sequence of these probes is designed so that they form a hairpin structure in which the fluorescent dye and the quencher are in close proximity. A Molecular Beacon specific for the sequence of interest is used in PCR. The probe is designed to anneal between the PCR primers. When the probe hybridizes to its target sequence in the PCR annealing step, the loop opens and the fluorescent reporter and quencher are separated, resulting in a fluorescent signal. The amount of signal is proportional to the amount of target sequence, and is measured in real-time to allow quantification of the amount of target sequence. In order to successfully monitor PCR, Molecular Beacons should be designed so that they are able to hybridize to their targets at the annealing temperature of the PCR, whereas the free Molecular Beacons should remain closed and be non-fluorescent at these temperatures. This can be ensured by choosing the length of the probe sequence and the length of the arm sequences appropriately. The length of the probe sequence should be such that it will dissociate from its target at temperatures 7–10 °C higher than the annealing temperature of the PCR. The melting temperature of the probe target hybrid can be predicted using the "percent-GC" rule, which is available in most probe design software packages. The prediction should be made for the probe sequence alone before adding the stem sequences. In practice, the length of the probe sequence is usually in the range from 15–30 nucleotides.

When not bound to its target sequence, the Molecular Beacon forms a hairpin structure. The proximity of the fluorescent reporter with the quencher prevents the reporter from fluorescing. During the PCR annealing step, the Molecular Beacon probe hybridizes to its target sequence. This separates the fluorescent dye and reporter, resulting in a fluorescent signal. The amount of signal is proportional to the amount of target sequence, and is measured in real-time to allow quantification of the amount of target sequence.

- Tm of probe + target hybrid (loop only) has to be 7–10 °C above Tanneal
- Tm of stem is 7–10 °C higher than the detection temperature (=annealing temperature of the PCR)
- The loop of the probe should be 15–30 nucleotides long
- The stem of the probe should be 5–7 bases on each side
- The amplicon should be less than 150 bp
Why did my PCR reaction stop working?
If your PCR reaction used to work and then stopped, the primers or template may have become degraded. The primers can last up to 1 year if stored lyophilized and aliquoted at –20 °C. Freezing and thawing causes the primers to degrade. Primers or template can also degrade due to contamination. Millipore filtration systems, which require the filter to be changed periodically, can supply water of questionable quality at the end of a cycle. If you are using a filter system, check to see if your filter was changed soon after resuspending your oligos. You may want to consider changing the filters more often if this is the case.
Why do I see extra bands in my PCR product?
Complementary primers can cause PCR artifacts, especially in control lanes (without template). The primers anneal to each other and extend, sometimes creating large products. The extra bands that appear in the control lane often disappear in the presence of competing template. Depending on the degree of complementarity, raising the annealing temperature may help if there are extra bands in other lanes.
Why does the yield differ between syntheses of the same sequence or length oligo?
The yield has many contributing factors. The primary reason why you might see different yields for the same oligo is that the columns are not loaded with exactly the same quantity of CPG. For example, a 50 nmol column will have a minimum of 50 nmols of 3' base available to start synthesis, but frequently has more than this amount. Keep in mind this is the starting scale and not the final yield.
Why are my measured yields lower than the ones provided by Eurofins Genomics?
The most common reason for this is that the oligos are not fully dissolved. If you resuspended in water, you may need to add NaOH to raise the pH to between 7 and 8. Oligos resuspended in water tend to have a pH of around 5, and this is often too low for them to completely dissolve. We recommend that most oligos be resuspended in TE at pH 7. We find that 10 mM Tris-HCl, 1 mM EDTA works well, but if your experiment cannot tolerate EDTA, you may use just Tris-HCl.
How are oligonucleotides quantified?
Oligonucleotides are most commonly quantified by measuring their UV absorbance at 260 nm. A single-stranded oligonucleotide dissolved in a neutral aqueous solution at a concentration of 33 µg/ml will have an absorbance at 260 nm of approximately 1.0 A.U. The optical density (OD) unit is defined as the absorbance (at 260 nm in a 1 cm cuvette) multiplied by the sample volume (in milliliters), so that 1 OD unit is roughly 33 µg of ssDNA.
Why does Eurofins Genomics call their basic purification oligos: Salt-Free?
Unlike most oligo manufacturers, Eurofins Genomics does not use liquid ammonia for deprotection. As our oligos are never exposed to ammonia they are not contaminated with ammonia salts. To increase the purity of our basic oligo further, we also desalt all oligos to remove any chemicals left from the synthesis and deprotection processes. This is why our oligos are called salt free.
What kind of HPLC purification is performed?
When HPLC purification is ordered, several methods of HPLC purification could be used. For unmodified oligos, ion exchange purification is often performed as this method typically provides the best separation of full length oligos from the lesser products. On certain modified oligos we use reversed-phase HPLC as the modification increases the hydrophobicity of the modified versus unmodified oligos providing the best separation for these products. Two-step HPLC purification, which includes reversed-phase HPLC followed by ion exchange HPLC, is recommended for oligos longer than 70 bases.
Should I have my oligos purified?
The following chart indicates standard purification levels for different applications. For any oligo longer than 70 bases, 2-step purification methods are highly recommended. If you are unsure of which purification method to order, please consult the protocol for your intended application. Recommended purification levels:
Application Salt-Free HPSF HPLC PAGE
PCR & qPCR Primers    
qPCR probes      
Multiplex PCR    
DNA Sequencing      
Microarray  
Blotting  
cDNA Library Construction    
Primer Extension    
454 Fusion Primer    
Antisense    
Cloning (Chemical Linkers)  
END Labeling & Fish      
Genotyping & SNPs    
Kinasing      
Crystallography      
Gel Shift Assays      
Gene Synthesis      
Mutagenesis      
= Unmodified DNA oligo, = Modified DNA Oligos
What is the difference between HPSF and HPLC purifications?
HPSF purification produces salt-free oligos in high yields. Typical purity levels are about 70%, but no guarantee of purity is made. HPSF purity oligos can be used in any application where salt-free oligos are used, but a little extra purity is desired.
HPLC purification uses reversed-phase or ion exchange HPLC columns to produce oligos with 85%+ purity levels. It is available for a wider range of oligo types.
If the Synthesis Scale is 50 nmol, will the final yield be 50 nmol?
No. The scale of synthesis is the amount of the 3'-terminus base that the multi-step synthesis started with, it is NOT the expected final yield. The yield depends on the size of the oligonucleotide, the coupling efficiency, and the base composition. The datasheet included in each oligo shipment contains all the necessary data pertaining to that order. For PCR the 50 nmol scale yields approximately 1,000 to 5,000 reactions and the 0.2 µmol scale yields 4,000 to 20,000 reactions (100 µl @ 0.1 to 0.5 µM).

Frequently Asked Questions - Sequencing

General Questions and Recent Changes

How do I download my Sequencing Results?
Go to your Order History. Next, click an order to expand and reveal the download link. To visit the Order History page, click one of the many links located throughout the website, including in the header beside your account information, the main menu, and the order now menu.
Free barcodes are not working for me, what should I do?
If you remove the hyphen in the barcode number, it should work fine.  Barcode numbers can only contain digits in the new system.  Entering a hyphen, space, period or other invalid character will cause problems.

SimpleSeq Kit Questions

General information on SimpleSeq
Besides ensuring that the samples submitted in the Barcode Labeled tubes for the SimpleSeq kits are shipped securely, there are several other benefits that you get when you get a SimpleSeq kit. These include the ability to share these kits easily with your colleagues/team members, ability to submit sample quanity for upto 4 reads in a single tube, ability to monitor the usage of sequencing reactions usage, ability to activate your kit, and the ability to add rxns to your kit using FlexPacks or FlexReads. Furthermore, now you can do all these on our e-commerce site; you do not have to call our Genomics Speacialists for any of these activities.
How to use a SimpleSeq Kit if I am the sole buyer and the user of the kit?
If the Webless or the Standard kit(s) has been purchased under your account, you do not have to do anything. The kit is automatically added to your account and you will see the kit listed in your Sequencing Dashboard. You can place orders without having to manually activate the kit. Please note that this is change from the previous process wherein you had to manually activate the kit before placing the orders.
How to use a SimpleSeq Kit if I am the Lab/Purchasing Manager? I buy the kits and give it to my colleagues who use them.
After you handover the unused SimpleSeq kit to your colleague, you can either 'assign kit' to him/her, or ask him/her to 'activate kit'. Please note that, as the giver, you will have to 'assign' the kit (see instructions below), while he/she, as the 'receiver' will have to 'activate' the kit (see instruction below) to ensure that the kit and the prepaid reactions are added to end-users online account. Please note that once a kit is assigned (or activated by the receipient), the kitcode and the associated reactions will be removed from your sequencing dashboard and traferred to the receipient dashboard.
How do I activate a kit?
SimpleSeq Kits are now auto-activated. Meaning, the kit is automatically added to your account when shipped. The kit will appear in your sequencing dashboard. There is no need to manually activate it.
If you colleague has 'assign'ed the kit to you, you will see the kit barcode already listed under your account on your sequencing dashboard with 96 additional sequecning reactions. If you do not see the barcode of the kit listed on your sequencing dashboard, you will need to activate the kit online. Login to your account and go the Sequencing Dashboard. Open the Activate Kit control in the sidebar, then type in the kit barcode and click the "activate" button. Alternately, you can activate the kit by simply entering the barcode labels of the tubes in the tube sequencing order. Please note that the Premixed kits do not require you to submit orders online; in this case, activating the Premixed Kits allows you to see the sequencing data on your account.
How do I share my kit with others in the lab?
A SimpleSeq Kit will be automatically shared when your colleague(s) orders a tube sequencing services with the sample submitted in the barcoded tube from your kit. Sharing indicates that the kit and its component barcoded tubes (used, in use, and yet to be used) can be viewed from your and your colleagues Sequencing Dashboard. Each members sharing a kit can view the purchased and user of each barcodes tube belonging to that kit. Moreover, you can also share a kit with your colleague by using the 'Share Kit' feature in the sequencing dashboard page:
  1. Go to the sequencing dashboard
  2. Click on 'Share kit' located on the side bar to open the interface
  3. Enter the Kit barcode number that you want to assign
  4. Enter the username (log in name at www.eurofinsgenomics.com) of the assignee
  5. Hit 'Share Kit'.
  6. Your colleague can now view the available number of barcoded tubes or sequencing reactions from their sequencing dashboard and plan their experiments or order sequencing services accordingly.

When you 'share kit' with your colleague(s), the number of available reactions will be displayed on the sequencing dashboards in both your accounts. When either of you use a reaction, the number of used reactions will be deducted from each of your accounts in the sequencing dashboard.

How can I assign a kit to my colleague?

As an owner/purchaser of SimpleSeq kits, you can physically distribute the kits to your colleague, co-worker, or your lab member and then 'assign' the kit to them online or ask them to 'activate' the kit. When you assign a kit using the sequencing dashboard, the kit, along with the barcodes of the tubes contained within the kit, is automatically transferred to asignee in our Barcode Management System; this makes the sample submission process easier for the assignee. To assign a kit:

  1. Go to the sequencing dashboard
  2. Click on 'Assign kit' located on the side bar to open the interface
  3. Enter the Kit barcode number that you want to assign
  4. Enter the username (log in name at www.eurofinsgenomics.com) of the assignee
  5. Hit 'Assign Kit'

When you assign a kit, your account will no longer display the kit details in your account; instead the barcodes associated with the kit and the tubes will appear in the account of the assignee. If you want to simply hand over the kit to your student or colleague, you can ask him/her to 'activate' the kit. Such activation will ensure that the barcodes associated with the kit are transferred to his/her account and will be identified when he/she places a sequencing order and not be charged for the same. Please note that you can only assign the kit when have not yet used a single tube. If you would like to distribute barcode labeled tubes to your colleagues after having used up a few to submit your samples, please see share kit.

How can I place orders for tube sequencing services using barcoded tubes from the SimpleSeq Kits

To use the SimpleSeq Premixed kit, assemble your pre-mixed samples in the tubes and ship them to us; you must not submit the order online.

To use the SimpleSeq standard kit, assemble your samples and provide the details of your sample and the sequencing reaction condition using the tube sequencing order editor. Use the barcodes to ensure that you are not charged for these reactions. We have recently introduced FlexReads to provide a convenient ordering experience for SimpleSeq Standard kit users. This feature will allow you to place higher volumes of sequencing orders using the tubes from Standard Kits without calling our representatives for activating the kit.

Excel template and ordering sequencing services related questions

My Samples are of different sizes, yet I see only one field to select my template size. Why?
Traditionally, we did collect the size of each sample. This was a rather tedious process for you and most of our order contained samples of similar sizes. To reduce the amount of time you invest in placing a sequencing order, we have taken steps to make the ordering process simpler. Our laboratory requires the template size in two independent scenarios (both related to PCR Products):
  1. Power Read sequencing service: this size of the PCR products helps in pipetting out the required volume for the desired concentration.
  2. Quality Assurance: each sequence is verified by a Quality Control specialist before the results are available for your viewing. A sequence terminated early can either indicate a failure of the sequencing reaction or indicate a sample with a short template size (e.g., PCR product with <300 bps). The provided size is then used as a reference for the QA.

In all other cases, when the samples are prepared based on the sample preparation guidelines, the size of the sample does not play any role in us being able to offer our services to you.

I have plasmids and PCR products that I want to submit in a 96-well plate. Which sample type should I select?
You can use the Plate Sequencing template (available here). Please select mix of both as the sample type.
I get an error messages when I try to upload a filled excel template in the plate sequencing order editor. How can I fix this?
With the recent upgrade in the Eurofins Genomics web portal, there have been several changes that can impact the template upload process. The following are the most likely reasons for the failure in uploading.
  • Incorrect template: the wrong excel template is being uploaded. New templates have been prepared for each plate sequencing order editor. Ensure that the relevant filled excel template is being uploaded. Please do not use excel templates from the legacy Operon site.
  • Altered Text Fields: The validation parameters in the order controls are tailored for the texts in cells with blue background. When these texts are edited or changed, the validation fails and the template will not be validated. Please refrain from making any edits on the pre-poplulated cells.
  • Invalid characters: Most fields in order control UI have been configured to accept alphanumeric characters. Avoid using special characters, e.g., #, @, %, etc., in the names of your primers or samples.
How can I name my plate in the excel template?
In the excel templates for plate sequencing services, each worksheet represents a sample-containing plate. The names of the sheets are Plate 01, Plate 02, etc. To provide a custom name for your plate, edit the name of the excel sheet. Remember to label your plate legibly using a marker or paste a free barcoded label to the bottom of the plate.

Technical questions

What is the average read length expected with one sample and a single primer
The average read length for a standard sequencing read from one direction (one sample, one primer) is 750-1000 bps.
I have a SimpleSeq kit, I have tubes still available but when I place the order, it charges me a fee of $5.00 per read.
This is because your account ran out of reactions associated with that kit. With each SimpleSeq kit, 96 sequencing reactions with Standard read conditions are provided. Nevertheless, you can use more than 96-reactions when you use multiple reactions (using different primers) for a sample submitted in a single tube. Consequently, when you run out of reactions but have unused tubes to submit your samples, the 'extra' sequencing reactions are charged at $5.00/sequencing reaction.
Do you offer any service for difficult regions? I have a webless kit, can I still use this service?
Yes, we do! Our Power read service is specialized for difficult regions like GC rich regions, repeats or secondary structures etc. Unfortunately, it is not available with SimpleSeq Premixed sequecing service. However, it is available with our SimpleSeq Standard service; please note that a power read upgrade fee will be charged per reaction. This power read is also available for samples submitted in custom centrifuge tubes.
My Samples are not in the recommended range as per your guidelines, can you dilute them?
Unfortunately, we do need offer dilutions on Samples availing our Standard chemistry for sequencing. However, our Power read service can take care of this request. We offer sample quantitation and adjustment to the recommended range with this service.
Do you store the samples and primers to be used on future orders?
Yes, we do! We store your samples and enclosed primers for 5 days by default. If you like to have the sent primers stored for 30 additional days, please indicate the same while placing the order. Please note we store the synthesized primers for 6 months. See the primer management tool for more details (will require login).
Sequencing results from the Ready2load plate sequencing service are dismal. What can you/I do to improve the sequencing data?
Please note that we treat each sample with utmost care, nevertheless, unexpected events in our lab can sometimes lead to bad sequencing results. We will inform you in such scenarios. Meanwhile, the actions you can take to ensure that you get best the sequencing data when ordering a Ready2Load Plate sequencing service are the following:

Possible Cause(s)

Recommended Action

Loss of labeled product during purification of extension products.

Review protocol for post-reaction dye terminator removal and ensure that all reagents are at the correct concentration and ethanol solutions are prepared fresh daily

Thermal cycler malfunction

Determine with the manufacturer how to test your thermal cycler for proper performance.

One of the components of the sequencing reaction (template, primer, or Ready Reaction Mix) was either omitted, was the wrong material, or was of poor quality.

Review the entire experiment carefully.

1. Check the quantitation and quality of the sequencing reaction components.

2. For each component, replace the component, perform a sequencing run, then evaluate the results until you have identified the problem or replaced all of the reaction components.

3. Run a DNA template control to determine whether the sequencing reaction failed or the template quality is low.

Insufficient template added to sequencing reactions, leading to too few sequencing products generated during PCR.

Check DNA quantitation and quality

Template contains sequencing inhibitors such as phenol

Follow recommended procedures to prepare templates. Check DNA quality. If necessary, clean up dirty templates.

No enzyme activity because Ready Reaction Mix was stored improperly or it separated upon storage.

Check the color of the Ready Reaction Mix. If the color is not uniform, the Ready Reaction Mix separated upon storage. Mix the Ready Reaction Mix gently before using it. Run a DNA template control to test enzyme function

Weak priming because of poor primer design.

Review primer design: Make new primers, then repeat the sequencing experiment.

I do not see the sequence of my primer in the sequence data. Was there a problem with my sequencing reaction?
There was no problem with your sequencing reaction. The sequence of the primer is not expected to be returned in the sequence data; furthermore, you will also notice that the initial 20-40 bases following the 3′ end of the primer are not determined accurately due to poor resolution. This is consistent with the behavior expected with Sanger method of sequencing. However, the sequence of the primer is typically determined by using a primer to sequence the complimentary strand. By assembling the two reads, a consensus sequence can be generated that includes segments corresponding to both the primer sequences.
I want to have my template sample read using both the forward and reverse primers. How do I indicate this on the order form?
Please use the same sample (and barcode) twice on the order form and enlist the respective forward and reverse primers against it. Thus, there would be two line items. You can submit the sample in just one tube as per our sample submission guidelines.
Can you sequence PCR products labeled with FAM, ROX or SyBR Green dyes?
We cannot sequence FAM- and ROX-labeled Samples. Fluorescence from the dyes will interfere with the sequencing results. Please note that we do sequence samples containing the SyBR Green dye—our PCR clean-up service can remove them from the sample. Please indicate the additional service when you place the order.
Can your sequencing conditions read dUs in the sample template?
Yes, our Standard sequencing chemistry can read dUs in the sequence. Please note that dU is read as dA in the Sanger method of Sequencing and treated as modified DNA base. If there are repeats of dUs in your template sequencing, we recommend the use of Power read sequencing service.
Can you sequence RNA?
Unfortunately, we do not offer RNA sequencing services. On account of the presence of the 2′-OH group, RNA is relatively more unstable when compared to the DNA with same sequence; RNA is susceptible to cleavage by RNases. To sequence your RNA samples directly, please reach out to appropriate service provider.

 

DNA Sequencing Troubleshooting Guide

Show me examples of chromatogram of successful DNA Sequencing experiments?
Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry stabilizes.

Examples:

Toubleshoot1

Why does a DNA Sequencing Reaction fail? What can I do to improve the sequence data?

Sequence Appearance:

  • Chromatogram data looks messy or is mostly blank.
  • Many "N's" in the sequence, if bases are called at all.
  • Blast search from .seq or fasta file yields unexpected results.
  • Raw data has signal intensity in the low hundreds.

Examples:

Seq Improving1

Possible Causes:

It is difficult to pinpoint a specific cause for the failure when there are no data for review. Common causes are:

  • DNA Template concentration is too low – Note: measuring DNA concentration by UV absorption is often inaccurate and concentration is frequently overestimated. Agarose gels are a better method to estimate quality and quantity of DNA samples.
  • Wrong primer or no primer was added to the reaction – binding between the DNA and the primer cannot occur in either of these instances.
  • Low quality prep – yields incomplete removal of protein and/or RNA, or buffer salts or other chemical contamination may be present. Any of these conditions can inhibit sequencing reaction enzymes.

Treatment:

  • Check the concentration of your template by agarose gel to ensure that it falls with the ranges listed in the Sample Submission Guidelines.

  • Check the primer sequence against the template sequence to ensure that there is a proper building site.
    a) Prepare fresh stock options for the template prep and dilution just prior to submitting samples.
    b) Prepare plasmid DNA using a commercial mini-prep kit.
    c) A final ethanol precipitation after the prep may help to ensure success.
I see Double Sequence Data. How can i rectify this?

Sequence Appearance:

  • Sequencing peaks are not Multiple peaks with the same height or of differing heights, overlapping one another.
  • Raw data has adequate signal intensity, indicating that the double peaks are not due to weak signal and/or background noise.

Seq Improving2

Possible Causes:

  • Clone contamination – in this case, the beginning of the sequence is often clean and becomes "dirty‟ as the progresses past the clone insertion site.
  • PCR template may be heterozygous due to indels present in a diploid (or polyploid) organism.
  • Two primers may have been mistakenly added to the sequencing reaction.
  • PCR products were not purified (or the purification was not performed properly). In this case, residual PCR primers may participate in the sequencing reaction.
  • There may be enough homology in another area of the template that where the sequencing primer begins extension.

Treatment:

  • If clone contamination is expected, please return to your clone resource and replate the bacteria onto selection media. You may want to select up to 12 clearly separated clones for sequencing to ensure you find the actual clone of interest.
  • Where PCR template heterozygosity is suspected, examination of the some indication of the area of heterozygosity. Newly designed PCR primers that yield shorter products may allow you to discern where the troublesome area is. Alternatively, you may decide to redesign the sequencing primer close to the area where the problem first arises hoping to find a primer that will sequence one of the product species. If the PCR product is large, subcloning the template into shorter pieces may also provide a strategy for discerning the true sequence of the area of interest.
  • When you suspect that two different primers may have been added to the reaction, you can simply repeat the reaction. If the working solution for the sequencing primer may be contaminated then going back to your original uncontaminated stock solution to prepare a new working solution or resynthesize the primer.
  • Check your PCR purification protocol and the solutions used in the clean-up reaction.
  • Check the primer sequence against the template sequence to ensure that there is a single binding site. Where sequence is unknown, you may need to switch to a different sequencing primer to eliminate the problem.
I see a noisy background in the chromatogram

Sequence Appearance

Background noise and odd peaks are present underneath the main sequence peaks.

Example:

Troubleshoot5

Possible Causes:

  • Clone contamination – in this case, the beginning of the sequence is often clean and becomes "dirty‟ as the sequence progresses past the clone insertion site.
  • PCR template may be heterozygous due to indels present in a diploid (or polyploid) organism.
  • Two primers may have been mistakenly added to the sequencing reaction.
  • PCR products were not purified (or the purification was not performed properly). In this case, residual PCR primers may participate in the sequencing reaction.
  • There may be enough homology in another area of the template that where the sequencing primer begins extension.
  • If clone contamination is expected, please return to your clone resource and replate the bacteria onto selection media. You may want to select up to 12 clearly separated clones for sequencing to ensure you find the actual clone of interest.
  • Where PCR template heterozygosity is suspected, examination of the some indication of the area of heterozygosity. Newly designed PCR primers that yield shorter products may allow you to discern where the troublesome area is. Alternatively, you may decide to redesign the sequencing primer close to the area where the problem first arises hoping to find a primer that will sequence one of the product species. If the PCR product is large, subcloning the template into shorter pieces may also provide a strategy for discerning the true sequence of the area of interest.
  • When you suspect that two different primers may have been added to the reaction, you can simply repeat the reaction. If the working solution for the sequencing primer may be contaminated then going back to your original uncontaminated stock solution to prepare a new working solution or resynthesize the primer.
  • Check your PCR purification protocol and the solutions used in the clean-up reaction.
  • Check the primer sequence against the template sequence to ensure that there is a single binding site. Where sequence is unknown, you may need to switch to a different sequencing primer to eliminate the problem.
I see 'stuttering' after mononucleotide stretches

Sequence Appearance

Sequencing data quality is poor after stretches of 7 or more nucleotides of the same base.

Example:

Troubleshoot6

Possible Causes:

  • Polymerase slippage during DNA synthesis. This is a recognized limitation of the Sanger method.

Treatment:

Options to go around the stuttering artifact are:

  • Sequence from the reverse direction.
  • Use a poly-mononucleotide primer with a degenerate base (wobble) at the 3′ end of the primer.
I noticed a mid sequence stop or drop-Off

Sequence Appearance:

The DNA sequence suddenly stops or peak intensity drops off substantially. NOTE: Many popular cloning vectors have palindromes flanking their linker and may show the drop-off effect when sequenced. This is a limitation of the Sanger method, but it can many times be overcome with PowerRead technology.

Example:

Troubleshoot7

Possible Causes:

  • Secondary structures in the DNA template (e.g. hairpin loops, palindromes)
  • GC or GT rich regions
  • Sample is an siRNA construct

Treatment:

  • Power Read technology yields excellent results with these template types.
I have a top-heavy chormatogram

Sequence Appearance

Sequencing signal gradually drops off

Example:

Troubleshoot8

Possible Causes:

  • Excess DNA template or primer.
  • GC or GT rich template (from bisulfide treated DNA, for example)

Treatment:

  • Carefully quantify your DNA template and primer prior to sequencing.
  • Sequence from the reverse direction.
  • Use a poly-mononucleotide primer with a degenerate base (wobble) at the
I see spikes appearing randomly in the chromatogram

Sequence Appearance:

Sharp, high-intensity, multicolored peaks that randomly appear in the sequence

Example:

Troubleshoot9

Possible Causes:

  • The cause of spikes is not completely understood. One possible explanation is that an impurity or micro bubble passes through the camera view of the sequencing instrument, scattering light.

Treatment:

  • The surrounding sequence should still be correct and accurate if of good quality, please request your sample to be rerun if necessary.
The quality of the peaks have deteriorated early in the sequence

Sequence Appearance

Peaks become broad or oddly shaped very early on in the sequence.

Example:

Troubleshoot 10

Possible Causes

  • Salt or other impurities carried over from DNA isolation protocols, protocols.

Treatment

  • Use a commercial desalting kit to further purify the DNA template before sequencing.

 

Frequently Asked Questions - Gene Synthesis

General Technical Questions

What is the difference between a long oligo and a synthetic gene or GeneStrand?
Due to limitations in oligo synthesis chemistry and other practical considerations, oligos are produced as mixture of single-stranded DNA strands and are limited in length to ~200 nucleotides. Synthetic genes or GeneStrands, however, can extend to several thousand, double-stranded base pairs. Usually created as a sequence verified clones, these constructs may be the best tool for your custom/hybrid protein research needs. GeneStrands are the intermediate, linear dsDNA fragments obtained during the construction of the synthetic Genes.
What is the difference between genes (delivered cloned into a vector) and GeneStrands?
A gene that has been cloned into a vector has been fully sequenced and confirmed to have 100% sequence identity to the expected sequence. GeneStrands on the other hand are PCR products; this represents a mixture of correct and incorrect sequences due to errors incorporated during polymerase chain reaction. As a consequence of this property of the polymerase, subclones created after inserting the PCR products into a vector can show variations from the expected sequence. Whenever you use cloning methods that incorporate PCR products for your cloning experiments, we recommend sequencing at least 4–10 colonies to identify those with the expected sequence. Please note that when Eurofins Genomics delivers your cloned gene and any additional plasmid preps ordered by you, you will receive materials with the 100% correct sequence and a dried vector with the gene insert of a 100% correct clone.
What are the lengths of Genes/GeneStrands you can synthesize?
Using moderately long oligonucleotides, we can assemble genes and GeneStrands of lengths ranging from 100 to several thousands of base pairs. Currently, at our US facilities, we offer GeneStrands of lengths from 100–2,000 bp and Genes from 100–1,000 base pairs. For longer length genes, please contact our customer service at GenomicsSupport@eurofins.com.
Can you insert the gene in the vector of my choice?
No, on routine basis we do not offer this service anymore. For large volume orders, please contact GenomicsSupport@eurofins.com.
How do you optimize the sequence of the synthetic genes or GeneStrands gene fragments?
We have a proprietary software GENEiusTM that optimizes and adapts the sequence of the DNA, when requested, based on the codon usage of any organism using the provided DNA or amino acid sequence as the input. This optimization is performed in 4 different dimensions: • Codon optimization • Secondary structure avoidance • GC content optimization • Bad motif avoidance. GENEiusTM is integrated with or GeneStrands and Genes order editors.
You can use a version of the GENEiusTM here to test its capabilities; you will need to login using the provided user name and password.
How is sequence optimization by GENEiusTM different from that offered by other similar software tools?
We believe that sequence optimized using GENEiusTM will perform better in applications such as protein expression than the sequences optimized by other similar softwares. We have compared our optimized sequences with those optimized with other software packages. Download our White Paper to see the results.
Do I need to provide restriction sites in the sequence of my synthetic gene?
Yes, if you want your product to be susceptible for digestion by the relevant restriction enzymes. To add the restriction site, you can select specific 3′ and 5′ restriction enzymes from the drop down menu of the Gene Synthesis Ordering Wizard. The wizard will automatically add the appropriate DNA sequences to your gene. The complete gene sequence with restriction sites will be displayed for your review prior to moving your genes into the Shopping Cart.
What is the difference between a cloning vector and an expression vector?
A vector is a plasmid or small strand of DNA into which a non-native DNA fragment (usually a synthetic gene) can be inserted via restriction enzyme treatment followed by ligation. Cloning vectors are utilized primarily for the replication of the gene insert. Expression vectors on the other hand are genetically engineered to enhance and promote the transcription of the gene insert to facilitate the expression of large amounts of its recombinant protein within the host cell. Besides the presence of expression signals most expression vectors can be distinguished from cloning vectors by the presence of protein tags. Most of these tags are used to help in the purification of the recombinant protein from the proteins of the host cell.
What are protein tags?
Protein tags are peptide sequences appended to recombinant proteins to modify them for various post-translational applications. There are numerous types of protein tags for different applications. Some protein tags can be used in tandem to confer dual functionality. The following are a few examples of the uses of protein tags. • To aid protein folding in chaperone-deficient hosts (solubility tags) • To facillitate protein purification by changing chemical characteristics of the recombinant protein (affinity tags) • To label recombinant proteins (fluorescent tags).
Do your standard vectors have protein tags?
No. We do not provide protein-tagged vectors. If you would like a protein tag incorporated into your vector, you can add the protein tag sequence to your gene sequence.
Can I optimize my gene but leave protein tags intact?
Yes. To leave the segements of the sequence intact, you can insert the sequence of the protein tag into the 5′ and/or 3′ untranslated regions (UTRs) of the wizard. The UTRs in the wizard are not optimized by GENEius software.
What are Complex Genes/GeneStrands?
Our experience has shown that some features of the ds-DNA sequence or segments thereof can pose challenges for thier assembly. Since the synthetic genes are assembled by complentary pairing of individually synthesized oligos, it is challenging to design distinct pairs of strands when for sequence that present low variations—long monomeric, direct or indirect repeats. Moreover, some sequences with secondary structures or with series of Gs also present challenges for the synthesis of the oligos. The dsDNA sequences of Genes and GeneStrands containing such features are classified as 'complex' by GENEiusTM. The synthesis and assembly of Genes or GeneStrands takes much longer than that of standard genes.

Genes

What are the quality standards for your Gene Synthesis services?
We verify each synthetic gene using DNA sequencing of both strands and ensure 100% sequence accuracy for every synthetic gene. Our gene synthesis lab maintains the highest quality standards throughout the complete synthesis process. The quality management system for our Louisville, Kentucky facility has been certified to ISO 9001:2008 and ISO 13485:2003 standards.
How long will it take before I receive my gene?
The standard delivery times are: For Standard Genes (160–1,000 bp): 6 working days For every additional ~950 bp: +5 working days For Complex Genes: Please inquire Additional subcloning into customer vector: 5–10 working days
How do I order your Gene Synthesis service?
Click on the Order Now button to bring up the Gene Sythesis Ordering Wizard. This wizard will guide you through the process of entering your gene information, optimizing your gene sequencing, and selecting the proper vector and preparation scale. Upon completion of the wizard, your gene is placed in your Shopping Cart. After you have entered and optimized all of your genes, a simple checkout process will place the order with our lab.
In which applications can I use synthetic genes?
Among the many uses for synthetic genes are adapting codon usage for optimizing gene expression, for protein over-expression and/or protein engineering; as standards for Real Time PCR and standard PCR, mutagenesis studies, to construct hybrid genes, and the production of DNA vaccines.
How should a gene be designed?
The formation of potential hairpin structures of 4 or more bases should be avoided within your synthetic gene sequence. Also, sequences that are commonly associated with poor oligo quality such as long stretches of single or di-nucleotide repeats, or high GC content should be avoided. To achieve high levels of gene expression (protein production), we also recommend that you avoid sequences that introduce rarely used codons into a gene. Our proprietary GENEius sequence optimzation software will optimize your gene, even if your original sequence contains some of the problem sequences listed above. Even many native gene sequences benefit from optimization in addition to codon optimization for a non-native host.
What are some of the different techniques for assembling synthetic genes?
There are three different approaches for the assembly of synthetic genes. In the approach developed by Khorana (Gupta et al., 1968), a series of sequentially overlapping oligonucleotides are synthesized. As the complementary sequences of the oligos anneal, double-stranded DNA fragments containing nicks on both strands are formed. The nicks are repaired with DNA ligase, an enzyme that catalyzes the formation of a phosphodiester bond between the 5′-phosphate of one double-stranded oligo fragment and the 3′-hydroxyl terminus on an adjacent double-stranded oligo fragment. Another broadly used approach is the one developed by Narang (Scarpulla et al., 1982) making use of the template-directed and primer-dependent 5′ to 3′-synthesis capability of the large subunit of the enzyme DNA-Polymerase I (Klenow fragment). After end-to-end annealing of the oligos, Klenow uses deoxynucleosidetriphosphates to fill the gaps. Treatment with DNA ligase repairs any nicks in the resulting, double-stranded DNA. An alternative strategy has been developed, using very long oligonucleotide chains. In this approach (Rossi et al., 1982), two long oligos are synthesized and upon annealing, their 3′-ends will overlap. The construct is completed to a full length double-strand using a DNA polymerase to fill in missing bases. After treatment with the polymerase, overhanging ends are generated on the double-stranded fragment by digestion with the appropriate restriction enzyme. Typically all of these methods are followed by the molecular cloning of the gene into an appropriate vector, so technical limitations of subsequent cloning steps must be considered while developing the assembly strategy. For example, assemblies for larger genes may be divided into sub-assemblies which are sequenced to confirm 100% identity and then brought together to complete the full construct which receives a second round of sequencing to verify the full assembly.
Is de novo synthesis or site-directed mutagenesis preferable if I need to create variant constructs for my experiment?
When you need the mutations to be distributed across the whole gene, we recommend de novo synthesis. De novo synthesis allows you an opportunity to also optimize features of the gene such as codon usage, GC content, restriction sites, etc. Site-directed mutagenesis is best used when the modifications are few, or are clustered in a small area of the gene.

Facts & Myths around Gene Synthesis

It is not possible to synthesize complete plasmids de novo!
This is a myth. With our gene synthesis protocol we can not only synthesise genes of any length, we can also synthesise complete plasmids.

Synthetic genes are often created by assembling overlapping DNA oligonucleotides. With this method it is possible to create long fragments that will be finally assembled to one large synthetic gene. By adding a circularization procedure it is therefore possible to even create complete plasmids of any length. As we routinely work with E. coli, your “gene” (i.e. the new plasmid) must harbour an E. coli selection marker and an origin of replication, of course.

Still the question remains, why someone would like to create his / her own plasmid. Here are a few answers to that:

  • Custom antibiotic resistance, promoters, origin of replication, etc.
  • Custom multiple cloning site, tailor-made for your projects
  • No potential licensing issues if you want to use your plasmid commercially
  • Sequence optimization of the vector to the host organism, to regulate the expression levels of the gene(s) (e.g. antibiotic resistance etc.)
It is not possible to optimize non-coding sequences!

This is a fact! Due to the redundant nature of the DNA code more than one triplet codon can code for an amino acid e.g. Arginine is encoded by CGT, CGC, CGA, CGG, AGA, and AGG. The frequency of these codons differs across species. It is therefore possible to optimize a DNA sequence so it contains the same frequency of codons as seen in the organism where the gene will be expressed. The optimization also helps in the reduction of high GC regions and repeat regions in the gene.

This type of optimization is only possible however when the gene to be synthesized (or part of it) is coding for a protein sequence and therefore has codons that can be manipulated in this way. A non-coding stretch of DNA does not contain codons coding for an amino acid and therefore an optimization exploiting the redundancy of DNA cannot be applicable.
Codon optimization is the only advantage of Gene Synthesis!
This is a myth! Most researchers do use synthetic genes for improving the heterologous expression of their genes of choice. This is readily achieved via codon usage adaptation using Eurofins’ gene adaption and optimisation software “GENEius”. But there are many more advantages for using gene synthesis. Imagine your NGS data reveal a very interesting DNA sequence that you now want to analyse further. With gene synthesis you can simply order your DNA or RNA sequence, you just need to know the in silico sequence. Another advantage of gene synthesis is fast and reliable access to cDNA sequences that a few years ago would have been done via labour-, time- and cost-intensive cDNA synthesis. No RNA extraction, no RT-PCR, and no RACE is needed for getting perfect full-length cDNA when using gene synthesis. Unwanted restriction sites can be avoided during adaption and subcloning into your own expression vector is also possible. Of course you can combine your gene sequence together with promoter and enhancer elements, polyadenylation signals, restriction sites, etc.

 

Frequently Asked Questions - Next Generation Sequencing

Which next generation sequencing services does Eurofins Genomics offer?
Genome Sequencing
  • De novo sequencing of fungal genomes
  • De novo sequencing of higher eukaryotic genomes
  • De novo sequencing of BACs, Viruses and Plasmids


Transcriptiome Sequencing
  • De novo transcriptome Sequencing
  • Expression Profiling


Resequencing and Amplicons
  • Ultra Deep Amplicon Sequencing
  • Resequencing by Sequence Capture
  • Exome Sequencing


Bioinformatics and Special Services
  • Bioinformatic solutions like de novo assembly, mapping, transcriptiome analysis, amplicon variance analysis, etc.
  • Library services
  • Sample Preparation
  • NGS favorites.
How can I order Next Gen Sequencing Services?
As most of the Next Generation Sequencing projects have unique requirements, please ask for a custom quote. Our NGS specialists will work with you to tailor the services and generate a quote for your porject.
Where can I learn more about the various sequencing systems (Illumina, PacBio)?
Illumina:
You can find additional information about this new technique provided by Illumina Inc. at http://www.illumina.com/applications/detail/sequencing/dna_sequencing.ilmn.

PacBio RS:
You can find additional information about this technique provided by Roche Applied Science at http://www.pacificbiosciences.com/products/
What is the principle of the Illumina sequencing technology?
Both next generation sequencing technologies of Roche (454) and Illumina share a common approach, in that, before sequencing itself, the sequencing library has to be generated via PCR amplification of the DNA templates.
In the case of Illumina HiSeq 2000 or MiSeq, preparation of the sequencing library is done by bridge PCR, while the sequencing is done by a technology referred to as cyclic reversible termination.
In the bridge PCR primers and the DNA template are immobilised to the 2-dimensional surface. The primers are designed to target the adaptors of the DNA fragments so that the fragments bind to primers in their neighbourhood. Within each PCR cycle the fragments build so called bridges and the following denaturation leaves single stranded templates anchored to the surface. The copies remain local and form dense clusters. To sequence the clusters a universal primer is hybridized to the adaptor sequence of the DNA fragments.
NGS_FAQ1
Sequencing of clusters generated via bridge PCR is done by a technique called cyclic reversible termination. Thereafter, the polymerase extension is performed with reversible terminators. These are deoxynucleotides carrying a fluorophore and a blocking group. The 4 nucleotides have different fluorophores attached. The polymerase incorporates just 1 labelled nucleotide as the blocking group terminates DNA synthesis. Unincorporated nucleotides are washed away and the array is imaged to determine the identity of the incorporated nucleotide. This is followed by a cleavage step which removes the blocking group and the fluorophore. The resulting 4-colour images are used to decode the sequence.
NGS_FAQ2
When using Illumina HiSeq 2500 sequencing, how can you adjust the sequencing data output to my requirements?
Flow cells of the high-output-mode of the Hiseq 2500 instrument are physically subdivided into 8 channels. In 1 channel up to 180 million clusters can be sequenced from one or from both ends.
Given this huge data output, we often recommend pooling of several samples in one channel in order to save sequencing costs. Here we use molecular barcodes (stretches of specific nucleotides) to tag up to 12 unique samples in a single channel. This is appropriate for most applications, like mRNA sequencing or ChIP sequencing.answer
Can you sequence GC rich DNA or DNA with secondary structures or hairpin structures?
Yes. However, de novo assembly of genomes with high or low GC content remains challenging. In these cases, best assembly results are achieved by sequencing a combination of shotgun and long paired end libraries.
What kind of data do you deliver for Illumina HiSeq and MiSeq projects?
In the case of Illumina HiSeq and MiSeq sequencing we ship FASTQ files of each single read. Intensity values and image files are automatically deleted during the runs and therefore cannot be shipped.
Can I get a confidentiality agreement (CDA/NDA)?
Yes, we have templates ready for signature, or we can sign your company/institute agreement, after review.
Confidentiality is guaranteed as part of our quotation and general terms and conditions
Do I own intellectual property of my results?
Yes, we are a service provider, and as such, we do not claim any intellectual property.