Article page image

Eurofins Genomics is producing a bulk supply of probes and primers for many commercial companies developing their own COVID-19 assay, as well as labs who want to order the CDC and WHO assays for research use. This can be easily done by ordering the RT qPCR Probes and Primers from the normal ordering pages.

Furthermore, the CDC sequences were publicly provided and are available here. Researchers can order these primers and probes to create a panel in their lab, following the panel instructions from the CDC. These materials are provided for research purposes only. Eurofins Genomics does not claim that these materials are in any way endorsed or validated by the CDC.

Ordering

There are multiple ways to order s but the easiest is to use the custom DNA oligo order page since it accommodates both modified probes and primers. These materials are for research use only.

qPCR Probe Order Page

Custom DNA Order Page

Gene Order Page

Gene Fragments

 

CDC Approved Sequences

*These sequences can be entered on the custom DNA oligo tube order page.

2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel Primers and Probes

Name

Description

Oligonucleotide Sequence (5’>3’)

Label1

Working

Conc.

2019-nCoV_N1-F

2019-nCoV_N1

Forward Primer

5’-GAC CCC AAA ATC AGC GAA AT-3’

None

20 µM

2019-nCoV_N1-R

2019-nCoV_N1

Reverse Primer

5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’

None

20 µM

2019-nCoV_N1-P

2019-nCoV_N1

Probe

5’-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3’

FAM, BHQ-1

5 µM

2019-nCoV_N2-F

2019-nCoV_N2

Forward Primer

5’-TTA CAA ACA TTG GCC GCA AA-3’

None

20 µM

2019-nCoV_N2-R

2019-nCoV_N2

Reverse Primer

5’-GCG CGA CAT TCC GAA GAA-3’

None

20 µM

2019-nCoV_N2-P

2019-nCoV_N2

Probe

5’-FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1-3’

FAM, BHQ-1

5 µM

2019-nCoV_N3-F

2019-nCoV_N3

Forward Primer

5’-GGG AGC CTT GAA TAC ACC AAA A-3’

None

20 µM

2019-nCoV_N3-R

2019-nCoV_N3

Reverse Primer

5’-TGT AGC ACG ATT GCA GCA TTG-3’

None

20 µM

2019-nCoV_N3-P

2019-nCoV_N3

Probe

5’-FAM-AYC ACA TTG GCA CCC GCA ATC CTG-BHQ1-3’

FAM, BHQ-1

5 µM

RP-F

RNAse P Forward

Primer

5’-AGA TTT GGA CCT GCG AGC G-3’

None

20 µM

RP-R

RNAse P Reverse

Primer

5’-GAG CGG CTG TCT CCA CAA GT-3’

None

20 µM

RP-P

RNAse P

Probe

5’-FAM – TTC TGA CCT GAA GGC TCT GCG CG – BHQ-1-3’

FAM, BHQ-1

5 µM

           

Note: Oligonucleotide sequences are subject to future changes as the 2019-Novel Coronavirus evolves.

CLICK HERE to read the instructions for creating a panel, as provided by the CDC.

CDC Publications

  1. (2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  2. (2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  3. (2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  4. (2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].

World Health Organization WHO Approved Sequences

*NOTE: customers may experience a slight delay on the WHO sequences.

Name

Description

Oligonucleotide Sequence (5’>3’)

Comment

RdRP
gene

RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
  RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA use 800 nM per reaction
  RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV,
will not detect SARS-CoVuse
100 nM per reaction
and mix with P1
  RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe,
will detect 2019-nCoV, SARS-CoV
and bat-SARS-related CoVsuse
100 nM per reaction and mix with P2
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT Use 400 nM per reaction
  E_Sarbeco_R1 ATATTGCAGCAGTACGCACACA Use 400 nM per reaction
  E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nM per reaction
         

Disclaimer

  • These sequences are for research use only. It has not been tested or approved for clinical use.
  • These materials are impacted by the accuracy of the publicly shared SARS-CoV-2 genome sequences from the CDC or WHO. Eurofins Genomics is not responsible for issues pertaining to sequence design or accuracy of sequence design.
  • Eurofins Genomics makes no claims on the performance of these sequences. The sequences and all instructional information have been taken from the CDC’s publicly shared documents and WHO information and produced to the highest quality standards.
  • These materials can be impacted by many variables and uncontrolled processes, including factors pertaining to the customer’s lab and data analysis.
  • Due to the urgency of this crisis, this product lacks the usual set of compliance specifications such as stability tests, shelf life studies, storage conditions, and other data.
  • Eurofins Genomics is not, and does not claim to be, a primary, preferred or recommended source of the CDC or WHO coronavirus primer-probe panel. Eurofins Genomics is independently offering the sequences that were published by the CDC for use in coronavirus detection. These materials are for research use only. They have not been designed, tested, validated by CDC, nor are they in any way endorsed by the CDC or any other public health agency.