Fueling the Fight / Against a Global Crisis

Testkittopbox.jpg

Test Kits

Antibody and RT PCR Test Kits are available

Probestopbox.jpg

Custom Probes

qPCR Probes & Primers are available for your custom COVID-19 assay

Plasmidtop5.jpg

Plasmid Controls

Verify your assay or experiement quickly using a plasmid control

Millions of Test Kits / Produced under ISO & FDA Labs

Clean, Controlled Lab for IVD and Research on SARS-CoV-2

Eurofins Genomics operates 6 facilities worldwide including operations in Europe, United States, Japan, and India. Each production facility is producing SARS-CoV-2 material for IVD and research use under stringent quality controls. Eurofins Genomics US, which operates out of Louisville, KY, is accredited under ISO 13485, ISO 9001, and GMP, and it has additional CLIA and CAP accredited labs for clinical projects. In addition, all gene and gene fragment orders are sent to a completely seperate facility for production, isolating those sequences from DNA oligo production to reduce the risk of cross contamination. Lastly, the Louisville based facility has taken extra, precautionary measures to segment the downstream workflow and create different tracks for any product that could potentially cross over, so that these tracks never cross or use the same equipment. Eurofins Genomics US is proud to be a leading supplier of testing material during the SARS-CoV-2 crisis.

 

       

 

 

RAPID RESPONSE / TO CORONAVIRUS

virus1.png

Faster Production

Time is critical in a pandemic. Days, even hours, can have a profound impact on controlling the spread. Eurofins Genomics is proud to be one of the fastest suppliers of probes and primers for SARS-CoV-2, due to our unique logistical position and technology. Probes typically ship in 3 days, primers in 1 day, depending on order specifications.

virus2.png

Global Crisis, Global Player

Eurofins Genomics has 6 labs worldwide, which offers global test kit manufactures consistency and local production capabilities. It also creates redundancy in our operation so if one lab faces a lock down scenario.

90

ON TIME DELIVERY

SARS-CoV-2 orders are shipped fast, with a >90% on time delivery rate.

85

HPLC

Most commercial and research customers are looking for 85% purity of oligos for their SARS-CoV-2 assay in order to ensure accuracy.

CORONAVIRUS / PRODUCTS

Test Kits

The novel antibody tests for the qualitative detection of SARS-CoV-2 virus in human serum to aid in the diagnosis of Coronavirus (COVID-19).

Order Elisa Antibody Test Kits

 

View Options

 

 

 

SARS-CoV-2 qPCR Probes & Primers

Ultra fast Probes and Primers due to Eurofins Genomics US exclusive technology and logistical position.

qPCR Probe Order page

Custom DNA Oligo Order Page

View all options

 

Plasmid Controls for Verifying Test Kits

Each plasmid control is prestocked in individual tubes and shipped out the same day for rapid turnaround time.

Order Plasmid Controls

 

CDC & WHO / Sequences

CDC Approved Sequences

*Enter the CDC sequences can be entered on the custom DNA oligo tube order page or probe page. Information can change quickly so we encourage all customers to cross check this sequence information against the CDC's documents found here.

2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel Primers and Probes

Name

Description

Oligonucleotide Sequence (5’>3’)

Label1

Working

Conc.

2019-nCoV_N1-F

2019-nCoV_N1

Forward Primer

5’-GAC CCC AAA ATC AGC GAA AT-3’

None

20 µM

2019-nCoV_N1-R

2019-nCoV_N1

Reverse Primer

5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’

None

20 µM

2019-nCoV_N1-P

2019-nCoV_N1

Probe

5’-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3’

FAM, BHQ-1

5 µM

2019-nCoV_N2-F

2019-nCoV_N2

Forward Primer

5’-TTA CAA ACA TTG GCC GCA AA-3’

None

20 µM

2019-nCoV_N2-R

2019-nCoV_N2

Reverse Primer

5’-GCG CGA CAT TCC GAA GAA-3’

None

20 µM

2019-nCoV_N2-P

2019-nCoV_N2

Probe

5’-FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1-3’

FAM, BHQ-1

5 µM

2019-nCoV_N3-F

2019-nCoV_N3

Forward Primer

5’-GGG AGC CTT GAA TAC ACC AAA A-3’

None

20 µM

2019-nCoV_N3-R

2019-nCoV_N3

Reverse Primer

5’-TGT AGC ACG ATT GCA GCA TTG-3’

None

20 µM

2019-nCoV_N3-P

2019-nCoV_N3

Probe

5’-FAM-AYC ACA TTG GCA CCC GCA ATC CTG-BHQ1-3’

FAM, BHQ-1

5 µM

RP-F

RNAse P Forward

Primer

5’-AGA TTT GGA CCT GCG AGC G-3’

None

20 µM

RP-R

RNAse P Reverse

Primer

5’-GAG CGG CTG TCT CCA CAA GT-3’

None

20 µM

RP-P

RNAse P

Probe

5’-FAM – TTC TGA CCT GAA GGC TCT GCG CG – BHQ-1-3’

FAM, BHQ-1

5 µM

           

Note: Oligonucleotide sequences are subject to future changes as the 2019-Novel Coronavirus evolves.

 

World Health Organization WHO Approved Sequences

*NOTE: customers may experience a slight delay on the WHO sequences.

Name

Description

Oligonucleotide Sequence (5’>3’)

Comment

RdRP
gene

RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
  RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA use 800 nM per reaction
  RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV,
will not detect SARS-CoVuse
100 nM per reaction
and mix with P1
  RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe,
will detect 2019-nCoV, SARS-CoV
and bat-SARS-related CoVsuse
100 nM per reaction and mix with P2
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT Use 400 nM per reaction
  E_Sarbeco_R1 ATATTGCAGCAGTACGCACACA Use 400 nM per reaction
  E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nM per reaction
         

Disclaimer

  • These sequences are for research use only. It has not been tested or approved for clinical use.
  • These materials are impacted by the accuracy of the publicly shared SARS-CoV-2 genome sequences from the CDC or WHO. Eurofins Genomics is not responsible for issues pertaining to sequence design or accuracy of sequence design.
  • Eurofins Genomics makes no claims on the performance of these sequences. The sequences and all instructional information have been taken from the CDC’s publicly shared documents and WHO information and produced to the highest quality standards.
  • These materials can be impacted by many variables and uncontrolled processes, including factors pertaining to the customer’s lab and data analysis.
  • Due to the urgency of this crisis, this product lacks the usual set of compliance specifications such as stability tests, shelf life studies, storage conditions, and other data.
  • Eurofins Genomics is not, and does not claim to be, a primary, preferred or recommended source of the CDC or WHO coronavirus primer-probe panel. Eurofins Genomics is independently offering the sequences that were published by the CDC for use in coronavirus detection. These materials are for research use only. They have not been designed, tested, validated by CDC, nor are they in any way endorsed by the CDC or any other public health agency.

Publications

  1. (2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  2. (2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  3. (2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  4. (2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].

Media

Eurofins Genomics U.S. launches new SARS-CoV-2 plasmid DNA controls and increases its capacity to produce probes and primers, all of which being key components of SARS-CoV-2 RT-PCR testing

Eurofins Genomics expands capacity for probes and primers production for RT-PCR SARS-CoV-2 test kits
FDA Issues Emergency Use Authorization for Viracor Eurofins Coronavirus LDT

Eurofins’ U.S. Clinical Diagnostics Network Launches Coronavirus (COVID-19) Antibody Testing

Louisville lab producing synthetic DNA to develop thousands of COVID-19 test kits
Louisville lab on forefront of battling COVID-19
It's in their DNA: A Louisville company is playing a key role for coronavirus test kits

*For media inquiries or a media packet, please contact marketingus@eurofinsgenomics.com.

 

The Genomics of the Coronavirus

The coronavirus SARS-CoV-2 and resulting disease COVID-19 have reached almost every country on Earth… but compared with other infectious diseases such as the flu, there are still many unknowns about SARS-CoV-2. Scientists around the world are tirelessly researching the virus in order to understand it better and endeavor to find treatments. What is currently known about the genomics of SARS-Cov-2 and how is the information used in diagnostics?

What kind of virus is SARS-CoV-2?

SARS-CoV-2 is a RNA virus and belongs to the family of Coronaviridae and the genus Betacoronavirus. Its genome consists of a single-stranded positive-sense RNA. The peculiarity of single-stranded positive-sense RNA is that it can directly function as mRNA in the host cell and, therefore, is directly translated. In contrast, the RNA of a negative-sense single-stranded RNA virus first needs to be converted into positive-sense RNA in order to be translated (Figure 1).

Figure 1: Expression strategies of positive-sense and negative-sense single-stranded RNA viruses.

 

What are the genes of SARS-CoV-2?

The RNA genome of SARS-CoV-2 is approximately 30,000 nucleotides long and encodes 27 non-structural proteins and 4 structural proteins.

The 27 non-structural proteins include RNA-dependent RNA polymerase (RdRP) that was found to be highly similar to parts of the RdRP gene of coronavirus RaTG13 in bats. Other non-structural proteins are proteases and helicases for instance.

The 4 genes encoding structural proteins that essentially form the envelope of the virus are: 1. the spike surface glycoprotein of the virus (S), 2. the matrix protein (M), 3. the nucleocapsid protein (N), and 3. the envelope protein (E) (Figure 2).

Figure 2: Structure of SARS-CoV-2

 

The spike proteins on the surface of the virus seem to mediate the binding of the virus to the angiotensin converting enzyme 2 (ACE2) receptor of host cells and the entry into the host cells.

The M protein seems to be involved in formation of the spherical shape of the virus.

The N protein also called nucleoprotein is associated with the single-stranded RNA and together they form the nucleocapsid.

The E protein has been found to be the smallest of the 4 structural proteins.

The genomic composition of SARS-CoV-2 has been analyzed and the sequence is publicly available at the GenBank sequence repository. As of now, 104 strains of SARS-CoV-2 have been isolated and sequenced.

 

How is SARS-CoV-2 identified?

Molecular techniques have been shown to be highly suitable for the identification of SARS-CoV-2 infections. Specifically real-time RT-PCR (qRT-PCR) is utilized for the analysis of respiratory samples. Here, the RNA of SARS-CoV-2 is extracted from the respiratory samples and subsequently reverse transcribed into complementary DNA (cDNA). The cDNA is then used for real-time PCR amplification with specific primers and probes that target three regions of the viral genome:

  • The RdRP gene that is situated in open reading frame ORF1ab.
  • The E gene
  • The N gene

It has been suggested that the RdRP gene and the E genes show slightly higher analytical sensitivity than the N gene.

For identification purposes, it has been suggested to use assays that target two regions. One primer pair for the identification of a broader range of coronaviruses including SARS-CoV-2, and one primer pair that is specific for SARS-CoV-2:

  • The recommendation by a research group at Charité Universitätsmedizin Berlin, Germany, that is the basis of the WHO recommendation, is to first utilize a primer pair that targets different regions of the E gene to detect all SARS-related viruses. In case this leads to amplification, a second analysis with a primer pair that targets different regions of the RdRP gene is performed as confirmatory testing.
  • The utilization of a primer pair that targets the N gene and one that targets the ORF1b/RNAse P gene to confirm the results have also been proposed and are recommended by Centers for Disease Control and Prevention (CDC) (Figure 3).
Figure 3: Genomic organization of SARS-CoV-2

 

qRT-PCR can be performed in a one-step or a two-step assay. The one-step assay with reverse transcription and PCR amplification in one reaction is fast and gives reproducible results for high-throughput analysis:

  • The CDC utilizes a one-step qRT-PCR assay to detect a SARS-CoV-2 in samples. Here, primers and a fluorophore-quencher probe Black Hole Quencher-1 (BHQ1) and fluorescein amidite (FAM) are utilized. During amplification the fluorophore-quencher probe is cleaved, which results in the emission of a fluorescent signal.
  • Charité Universitätsmedizin Berlin, Germany reported to also utilise a one-step qRT-PCR assay. Here, the probes for the assay contained Blackberry Quencher (BBQ) and 6-carboxyfluorescein (6-FAM).

The two-step assay, where reverse transcription and PCR amplification are performed in different tubes, is generally more sensitive but requires more time.

The utilization of qRT-PCR assays requires positive controls for valid and reliable analyses.

What are the positive controls for SARS-CoV-2 identification by qRT-PCR?

A range of validated positive controls as plasmids that include all genes of SARS-CoV-2 as recommended by the CDC and WHO for example is also provided: Control Plasmids for Coronavirus Research.

 

References
Andersen, K.G., Rambaut, A., Lipkin, W.I., Holmes, E.C., Garry, R.F. (2020) The proximal origin of SARS-CoV-2. Nat Med. 26:450-2.
Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DKW, Bleicker T, Brünink S, Schneider J, Schmidt ML, Mulders DGJC, Haagmans BL, van der Veer B, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M, Peiris M, Goossens H, Reusken C, Koopmans MPG, Drosten C. (2020) Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 25(3):2000045.
Phan, T. (2020) Genetic diversity and evolution of SARS-CoV-2. Infect Genet Evol. 81:104260
Udugama, B., Kadhiresan, P., Kozlowski, H.N., Malekjahani, A., Osborne, Li, M., V.Y. C., Chen, H., Mubareka, S., Gubbay, J.B., Chan, W.C.W. (2020) Diagnosing COVID-19: The Disease and Tools for Detection. ACS Nano [Online ahead of print].

For information on additional products and services related to SARS-CoV-2, visit our satellite website on COVID-19.


TEST
Test Kits

Choose a SARS-CoV-2 plasmid control for verification needs.

PREVENT
Probes, Primers & Genes

    Research even better solutions with custom qPCR probes, primers, and genes.

PROD - HSV

| 9.0.88.78