Fueling the Fight / Against a Global Crisis

Testkittopbox.jpg

Test Kits

ELISA Antibody Test Kits are available

Probestopbox.jpg

Custom Probes

RT qPCR Probes & Primers are available for your custom COVID-19 assay

Plasmidtop5.jpg

Plasmid Controls

Verify your assay or experiement quickly using a plasmid control

Millions of Test Kits / Produced under ISO & FDA Labs

Clean, Controlled Lab for IVD and Research on SARS-CoV-2

Eurofins Genomics operates 6 facilities worldwide including operations in Europe, United States, Japan, and India. Each production facility is producing SARS-CoV-2 material for IVD and research use under stringent quality controls. Eurofins Genomics US, which operates out of Louisville, KY, is accredited under ISO 13485, ISO 9001, and GMP, and it has additional CLIA and CAP accredited labs for clinical projects. In addition, all gene and gene fragment orders are sent to a completely seperate facility for production, isolating those sequences from DNA oligo production to reduce the risk of cross contamination. Lastly, the Louisville based facility has taken extra, precautionary measures to segment the downstream workflow and create different tracks for any product that could potentially cross over, so that these tracks never cross or use the same equipment. Eurofins Genomics US is proud to be a leading supplier of testing material during the SARS-CoV-2 crisis.

 

       

 

 

RAPID RESPONSE / TO CORONAVIRUS

virus1.png

Faster Production

Time is critical in a pandemic. Days, even hours, can have a profound impact on controlling the spread. Eurofins Genomics is proud to be one of the fastest suppliers of probes and primers for SARS-CoV-2, due to our unique logistical position and technology. Probes typically ship in 3 days, primers in 1 day, depending on order specifications.

virus2.png

Global Crisis, Global Player

Eurofins Genomics has 6 labs worldwide, which offers global test kit manufactures consistency and local production capabilities. It also creates redundancy in our operation so if one lab faces a lock down scenario.

90

ON TIME DELIVERY

SARS-CoV-2 orders are shipped fast, with a >90% on time delivery rate.

85

HPLC

Most commercial and research customers are looking for 85% purity of oligos for their SARS-CoV-2 assay in order to ensure accuracy.

CORONAVIRUS / PRODUCTS

Elisa Antibody Test Kits

The novel antibody tests for the qualitative detection of SARS-CoV-2 virus in human serum to aid in the diagnosis of Coronavirus (COVID-19).

Order Test Kits

More information

 

 

 

SARS-CoV-2 qPCR Probes & Primers

Ultra fast Probes and Primers due to Eurofins Genomics US exclusive technology and logistical position.

qPCR Probe Order page

Custom DNA Oligo Order Page

View all options

 

Plasmid Controls for Verifying Test Kits

Each plasmid control is prestocked in individual tubes and shipped out the same day for rapid turnaround time.

Order Plasmid Controls

 

CDC & WHO / Sequences

CDC Approved Sequences

*Enter the CDC sequences can be entered on the custom DNA oligo tube order page or probe page. Information can change quickly so we encourage all customers to cross check this sequence information against the CDC's documents found here.

2019-Novel Coronavirus (2019-nCoV) Real-time rRT-PCR Panel Primers and Probes

Name

Description

Oligonucleotide Sequence (5’>3’)

Label1

Working

Conc.

2019-nCoV_N1-F

2019-nCoV_N1

Forward Primer

5’-GAC CCC AAA ATC AGC GAA AT-3’

None

20 µM

2019-nCoV_N1-R

2019-nCoV_N1

Reverse Primer

5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’

None

20 µM

2019-nCoV_N1-P

2019-nCoV_N1

Probe

5’-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3’

FAM, BHQ-1

5 µM

2019-nCoV_N2-F

2019-nCoV_N2

Forward Primer

5’-TTA CAA ACA TTG GCC GCA AA-3’

None

20 µM

2019-nCoV_N2-R

2019-nCoV_N2

Reverse Primer

5’-GCG CGA CAT TCC GAA GAA-3’

None

20 µM

2019-nCoV_N2-P

2019-nCoV_N2

Probe

5’-FAM-ACA ATT TGC CCC CAG CGC TTC AG-BHQ1-3’

FAM, BHQ-1

5 µM

2019-nCoV_N3-F

2019-nCoV_N3

Forward Primer

5’-GGG AGC CTT GAA TAC ACC AAA A-3’

None

20 µM

2019-nCoV_N3-R

2019-nCoV_N3

Reverse Primer

5’-TGT AGC ACG ATT GCA GCA TTG-3’

None

20 µM

2019-nCoV_N3-P

2019-nCoV_N3

Probe

5’-FAM-AYC ACA TTG GCA CCC GCA ATC CTG-BHQ1-3’

FAM, BHQ-1

5 µM

RP-F

RNAse P Forward

Primer

5’-AGA TTT GGA CCT GCG AGC G-3’

None

20 µM

RP-R

RNAse P Reverse

Primer

5’-GAG CGG CTG TCT CCA CAA GT-3’

None

20 µM

RP-P

RNAse P

Probe

5’-FAM – TTC TGA CCT GAA GGC TCT GCG CG – BHQ-1-3’

FAM, BHQ-1

5 µM

           

Note: Oligonucleotide sequences are subject to future changes as the 2019-Novel Coronavirus evolves.

 

World Health Organization WHO Approved Sequences

*NOTE: customers may experience a slight delay on the WHO sequences.

Name

Description

Oligonucleotide Sequence (5’>3’)

Comment

RdRP
gene

RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
  RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA use 800 nM per reaction
  RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV,
will not detect SARS-CoVuse
100 nM per reaction
and mix with P1
  RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe,
will detect 2019-nCoV, SARS-CoV
and bat-SARS-related CoVsuse
100 nM per reaction and mix with P2
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT Use 400 nM per reaction
  E_Sarbeco_R1 ATATTGCAGCAGTACGCACACA Use 400 nM per reaction
  E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nM per reaction
         

Disclaimer

  • These sequences are for research use only. It has not been tested or approved for clinical use.
  • These materials are impacted by the accuracy of the publicly shared SARS-CoV-2 genome sequences from the CDC or WHO. Eurofins Genomics is not responsible for issues pertaining to sequence design or accuracy of sequence design.
  • Eurofins Genomics makes no claims on the performance of these sequences. The sequences and all instructional information have been taken from the CDC’s publicly shared documents and WHO information and produced to the highest quality standards.
  • These materials can be impacted by many variables and uncontrolled processes, including factors pertaining to the customer’s lab and data analysis.
  • Due to the urgency of this crisis, this product lacks the usual set of compliance specifications such as stability tests, shelf life studies, storage conditions, and other data.
  • Eurofins Genomics is not, and does not claim to be, a primary, preferred or recommended source of the CDC or WHO coronavirus primer-probe panel. Eurofins Genomics is independently offering the sequences that were published by the CDC for use in coronavirus detection. These materials are for research use only. They have not been designed, tested, validated by CDC, nor are they in any way endorsed by the CDC or any other public health agency.

Publications

  1. (2020) 2019 Novel Coronavirus (2019-nCoV), Wuhan, China. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  2. (2020) 2019-Novel coronavirus (2019-nCoV) real-time rRT-PCR panel primers and probes. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  3. (2020) Real-time RT-PCR panel for detection 2019-novel coronavirus. US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].
  4. (2020) Emergency use authorization. [Online] US Centers for Disease Control and Prevention. [Accessed 28 Jan 2020].

Media

Eurofins Genomics U.S. launches new SARS-CoV-2 plasmid DNA controls and increases its capacity to produce probes and primers, all of which being key components of SARS-CoV-2 RT-PCR testing

Eurofins Genomics expands capacity for probes and primers production for RT-PCR SARS-CoV-2 test kits
FDA Issues Emergency Use Authorization for Viracor Eurofins Coronavirus LDT

Eurofins’ U.S. Clinical Diagnostics Network Launches Coronavirus (COVID-19) Antibody Testing

Louisville lab producing synthetic DNA to develop thousands of COVID-19 test kits
Louisville lab on forefront of battling COVID-19
It's in their DNA: A Louisville company is playing a key role for coronavirus test kits

*For media inquiries or a media packet, please contact marketingus@eurofinsgenomics.com.

 

 


TEST
Test Kits

Choose a SARS-CoV-2 plasmid control for verification needs.

PREVENT
Probes, Primers & Genes

    Research even better solutions with custom qPCR probes, primers, and genes.

PROD - HSV

| 9.0.88.78